Incidental Mutation 'R5321:Vmn1r5'
ID406105
Institutional Source Beutler Lab
Gene Symbol Vmn1r5
Ensembl Gene ENSMUSG00000090346
Gene Namevomeronasal 1 receptor 5
SynonymsV1rc19
MMRRC Submission 042904-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5321 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location56970273-56988390 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56985607 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 89 (L89P)
Ref Sequence ENSEMBL: ENSMUSP00000154081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164307] [ENSMUST00000226130] [ENSMUST00000228276]
Predicted Effect probably damaging
Transcript: ENSMUST00000164307
AA Change: L89P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131092
Gene: ENSMUSG00000090346
AA Change: L89P

DomainStartEndE-ValueType
Pfam:V1R 28 293 9.7e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226130
AA Change: L89P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228276
AA Change: L89P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,327,825 F72L probably benign Het
Btrc G A 19: 45,507,758 V211M probably damaging Het
Col6a5 A T 9: 105,928,465 Y1081N unknown Het
Cryzl1 T C 16: 91,707,230 Y109C probably benign Het
Dlec1 T A 9: 119,112,601 S352T probably benign Het
Dzip3 T G 16: 48,957,675 T349P possibly damaging Het
Endou A G 15: 97,721,032 V37A probably damaging Het
Exosc1 A T 19: 41,924,060 C129* probably null Het
Flywch1 C G 17: 23,756,651 R539P probably damaging Het
Gm14410 G A 2: 177,193,505 T322I probably damaging Het
Gm340 G T 19: 41,585,204 W799C probably damaging Het
Lpin2 G A 17: 71,246,858 V857M probably damaging Het
Olfr629 T C 7: 103,740,655 N195S probably damaging Het
Patl1 A G 19: 11,921,421 Q160R probably damaging Het
Phtf1 C T 3: 104,003,511 T606I probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Scrt1 T C 15: 76,519,170 S207G unknown Het
Slc15a5 G T 6: 137,987,438 N496K probably benign Het
Slc17a2 A T 13: 23,812,631 I40F possibly damaging Het
Tdrd12 A C 7: 35,478,094 V945G probably damaging Het
Tdrkh C A 3: 94,425,658 L169I probably damaging Het
Tmem59l A G 8: 70,487,215 C35R probably damaging Het
Tpte A T 8: 22,297,203 R33* probably null Het
Trpv2 T A 11: 62,584,571 L270H probably damaging Het
Utp18 A G 11: 93,866,434 L468P probably damaging Het
Uxs1 A G 1: 43,805,645 I51T probably damaging Het
Vmn1r20 C T 6: 57,432,442 S251L probably benign Het
Vmn1r24 A T 6: 57,956,197 L112* probably null Het
Vmn2r10 G T 5: 108,995,639 A815E probably damaging Het
Zfp119a A T 17: 55,865,595 L416H probably damaging Het
Other mutations in Vmn1r5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Vmn1r5 APN 6 56985926 missense probably damaging 0.98
IGL02027:Vmn1r5 APN 6 56985655 missense probably damaging 0.97
IGL03133:Vmn1r5 APN 6 56985615 missense probably benign 0.10
IGL03412:Vmn1r5 APN 6 56985933 missense possibly damaging 0.90
R0316:Vmn1r5 UTSW 6 56985799 missense probably benign 0.27
R0378:Vmn1r5 UTSW 6 56985585 missense probably benign 0.00
R0946:Vmn1r5 UTSW 6 56986165 missense possibly damaging 0.64
R1511:Vmn1r5 UTSW 6 56985786 missense probably benign 0.02
R1553:Vmn1r5 UTSW 6 56985498 missense probably benign 0.00
R1823:Vmn1r5 UTSW 6 56985595 missense probably damaging 0.98
R3980:Vmn1r5 UTSW 6 56985651 missense probably damaging 1.00
R4473:Vmn1r5 UTSW 6 56985648 missense probably benign 0.01
R4742:Vmn1r5 UTSW 6 56986251 nonsense probably null
R5364:Vmn1r5 UTSW 6 56985598 missense probably damaging 0.98
R6102:Vmn1r5 UTSW 6 56986114 missense probably damaging 0.96
R6581:Vmn1r5 UTSW 6 56985381 missense probably benign
R6885:Vmn1r5 UTSW 6 56986057 missense possibly damaging 0.89
R7297:Vmn1r5 UTSW 6 56986219 missense possibly damaging 0.94
R8063:Vmn1r5 UTSW 6 56985598 missense probably damaging 0.98
Z1176:Vmn1r5 UTSW 6 56985948 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TAGGTCACAGACGTAAGCCC -3'
(R):5'- AGTGAGCAGTATTTAGTAGCCTTC -3'

Sequencing Primer
(F):5'- CACAGACCTGATCTCCTGTCAACTG -3'
(R):5'- GGTCTCACTCACATTGGTATAAGCAC -3'
Posted On2016-07-22