Mutagenetix > Incidental Mutations

Incidental Mutation 'R5321:Olfr629'

406110

Institutional Source

Beutler Lab

Gene Symbol

Olfr629

Ensembl Gene

ENSMUSG00000047545

Gene Name

olfactory receptor 629

Synonyms

MOR26-2, GA_x6K02T2PBJ9-6466772-6465828

MMRRC Submission

042904-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.156) question?

Stock #

R5321 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103739775-103744943 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103740655 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 195 (N195S)

Ref Sequence

ENSEMBL: ENSMUSP00000149272 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051346] [ENSMUST00000213906] [ENSMUST00000216300]

Predicted Effect

probably damaging
Transcript: ENSMUST00000051346
AA Change: N195S

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000052662
Gene: ENSMUSG00000047545
AA Change: N195S

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	311	4.9e-103	PFAM
Pfam:7TM_GPCR_Srsx	35	307	1.6e-6	PFAM
Pfam:7tm_1	41	292	5.7e-15	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000213906
AA Change: N195S

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

Predicted Effect

probably damaging
Transcript: ENSMUST00000216300
AA Change: N195S

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.7%
20x: 96.3%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	G	11: 110,327,825	F72L	probably benign	Het
Btrc	G	A	19: 45,507,758	V211M	probably damaging	Het
Col6a5	A	T	9: 105,928,465	Y1081N	unknown	Het
Cryzl1	T	C	16: 91,707,230	Y109C	probably benign	Het
Dlec1	T	A	9: 119,112,601	S352T	probably benign	Het
Dzip3	T	G	16: 48,957,675	T349P	possibly damaging	Het
Endou	A	G	15: 97,721,032	V37A	probably damaging	Het
Exosc1	A	T	19: 41,924,060	C129*	probably null	Het
Flywch1	C	G	17: 23,756,651	R539P	probably damaging	Het
Gm14410	G	A	2: 177,193,505	T322I	probably damaging	Het
Gm340	G	T	19: 41,585,204	W799C	probably damaging	Het
Lpin2	G	A	17: 71,246,858	V857M	probably damaging	Het
Patl1	A	G	19: 11,921,421	Q160R	probably damaging	Het
Phtf1	C	T	3: 104,003,511	T606I	probably benign	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Scrt1	T	C	15: 76,519,170	S207G	unknown	Het
Slc15a5	G	T	6: 137,987,438	N496K	probably benign	Het
Slc17a2	A	T	13: 23,812,631	I40F	possibly damaging	Het
Tdrd12	A	C	7: 35,478,094	V945G	probably damaging	Het
Tdrkh	C	A	3: 94,425,658	L169I	probably damaging	Het
Tmem59l	A	G	8: 70,487,215	C35R	probably damaging	Het
Tpte	A	T	8: 22,297,203	R33*	probably null	Het
Trpv2	T	A	11: 62,584,571	L270H	probably damaging	Het
Utp18	A	G	11: 93,866,434	L468P	probably damaging	Het
Uxs1	A	G	1: 43,805,645	I51T	probably damaging	Het
Vmn1r20	C	T	6: 57,432,442	S251L	probably benign	Het
Vmn1r24	A	T	6: 57,956,197	L112*	probably null	Het
Vmn1r5	T	C	6: 56,985,607	L89P	probably damaging	Het
Vmn2r10	G	T	5: 108,995,639	A815E	probably damaging	Het
Zfp119a	A	T	17: 55,865,595	L416H	probably damaging	Het

Other mutations in Olfr629

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00965:Olfr629	APN	7	103740965	missense	probably benign	0.03
IGL01531:Olfr629	APN	7	103741114	missense	probably damaging	1.00
IGL02263:Olfr629	APN	7	103741055	missense	probably damaging	1.00
IGL02543:Olfr629	APN	7	103740503	missense	possibly damaging	0.50
BB005:Olfr629	UTSW	7	103741190	missense	probably damaging	1.00
BB015:Olfr629	UTSW	7	103741190	missense	probably damaging	1.00
R0744:Olfr629	UTSW	7	103740925	missense	probably damaging	1.00
R0836:Olfr629	UTSW	7	103740925	missense	probably damaging	1.00
R1509:Olfr629	UTSW	7	103741036	missense	probably benign	0.12
R1671:Olfr629	UTSW	7	103740410	missense	possibly damaging	0.73
R1781:Olfr629	UTSW	7	103740821	missense	probably benign	0.00
R1848:Olfr629	UTSW	7	103741174	missense	probably benign	0.08
R3930:Olfr629	UTSW	7	103740587	missense	probably damaging	1.00
R4125:Olfr629	UTSW	7	103741000	missense	probably benign	0.22
R6141:Olfr629	UTSW	7	103740787	missense	probably damaging	1.00
R6232:Olfr629	UTSW	7	103740454	missense	probably damaging	1.00
R6489:Olfr629	UTSW	7	103740668	missense	probably benign	0.09
R6755:Olfr629	UTSW	7	103740500	missense	probably damaging	0.99
R7526:Olfr629	UTSW	7	103740400	missense	probably damaging	1.00
R7928:Olfr629	UTSW	7	103741190	missense	probably damaging	1.00
Z1177:Olfr629	UTSW	7	103741068	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACTTGCAGGCACATTCTTGC -3'
(R):5'- ACGCCCATGGTGATTAAAATAGG -3'

Sequencing Primer
(F):5'- GCACATTCTTGCCAAAACGATGTG -3'
(R):5'- GCCCATGGTGATTAAAATAGGTCTAG -3'

Posted On

2016-07-22