Incidental Mutation 'R5321:Olfr629'
ID 406110
Institutional Source Beutler Lab
Gene Symbol Olfr629
Ensembl Gene ENSMUSG00000047545
Gene Name olfactory receptor 629
Synonyms MOR26-2, GA_x6K02T2PBJ9-6466772-6465828
MMRRC Submission 042904-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R5321 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 103739775-103744943 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103740655 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 195 (N195S)
Ref Sequence ENSEMBL: ENSMUSP00000149272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051346] [ENSMUST00000213906] [ENSMUST00000216300]
AlphaFold Q0VBH3
Predicted Effect probably damaging
Transcript: ENSMUST00000051346
AA Change: N195S

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000052662
Gene: ENSMUSG00000047545
AA Change: N195S

DomainStartEndE-ValueType
Pfam:7tm_4 31 311 4.9e-103 PFAM
Pfam:7TM_GPCR_Srsx 35 307 1.6e-6 PFAM
Pfam:7tm_1 41 292 5.7e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213906
AA Change: N195S

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000216300
AA Change: N195S

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,327,825 F72L probably benign Het
Btrc G A 19: 45,507,758 V211M probably damaging Het
Col6a5 A T 9: 105,928,465 Y1081N unknown Het
Cryzl1 T C 16: 91,707,230 Y109C probably benign Het
Dlec1 T A 9: 119,112,601 S352T probably benign Het
Dzip3 T G 16: 48,957,675 T349P possibly damaging Het
Endou A G 15: 97,721,032 V37A probably damaging Het
Exosc1 A T 19: 41,924,060 C129* probably null Het
Flywch1 C G 17: 23,756,651 R539P probably damaging Het
Gm14410 G A 2: 177,193,505 T322I probably damaging Het
Gm340 G T 19: 41,585,204 W799C probably damaging Het
Lpin2 G A 17: 71,246,858 V857M probably damaging Het
Patl1 A G 19: 11,921,421 Q160R probably damaging Het
Phtf1 C T 3: 104,003,511 T606I probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Scrt1 T C 15: 76,519,170 S207G unknown Het
Slc15a5 G T 6: 137,987,438 N496K probably benign Het
Slc17a2 A T 13: 23,812,631 I40F possibly damaging Het
Tdrd12 A C 7: 35,478,094 V945G probably damaging Het
Tdrkh C A 3: 94,425,658 L169I probably damaging Het
Tmem59l A G 8: 70,487,215 C35R probably damaging Het
Tpte A T 8: 22,297,203 R33* probably null Het
Trpv2 T A 11: 62,584,571 L270H probably damaging Het
Utp18 A G 11: 93,866,434 L468P probably damaging Het
Uxs1 A G 1: 43,805,645 I51T probably damaging Het
Vmn1r20 C T 6: 57,432,442 S251L probably benign Het
Vmn1r24 A T 6: 57,956,197 L112* probably null Het
Vmn1r5 T C 6: 56,985,607 L89P probably damaging Het
Vmn2r10 G T 5: 108,995,639 A815E probably damaging Het
Zfp119a A T 17: 55,865,595 L416H probably damaging Het
Other mutations in Olfr629
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Olfr629 APN 7 103740965 missense probably benign 0.03
IGL01531:Olfr629 APN 7 103741114 missense probably damaging 1.00
IGL02263:Olfr629 APN 7 103741055 missense probably damaging 1.00
IGL02543:Olfr629 APN 7 103740503 missense possibly damaging 0.50
BB005:Olfr629 UTSW 7 103741190 missense probably damaging 1.00
BB015:Olfr629 UTSW 7 103741190 missense probably damaging 1.00
R0744:Olfr629 UTSW 7 103740925 missense probably damaging 1.00
R0836:Olfr629 UTSW 7 103740925 missense probably damaging 1.00
R1509:Olfr629 UTSW 7 103741036 missense probably benign 0.12
R1671:Olfr629 UTSW 7 103740410 missense possibly damaging 0.73
R1781:Olfr629 UTSW 7 103740821 missense probably benign 0.00
R1848:Olfr629 UTSW 7 103741174 missense probably benign 0.08
R3930:Olfr629 UTSW 7 103740587 missense probably damaging 1.00
R4125:Olfr629 UTSW 7 103741000 missense probably benign 0.22
R6141:Olfr629 UTSW 7 103740787 missense probably damaging 1.00
R6232:Olfr629 UTSW 7 103740454 missense probably damaging 1.00
R6489:Olfr629 UTSW 7 103740668 missense probably benign 0.09
R6755:Olfr629 UTSW 7 103740500 missense probably damaging 0.99
R7526:Olfr629 UTSW 7 103740400 missense probably damaging 1.00
R7928:Olfr629 UTSW 7 103741190 missense probably damaging 1.00
R8839:Olfr629 UTSW 7 103740814 missense probably benign 0.00
R8890:Olfr629 UTSW 7 103740468 missense probably damaging 1.00
R9209:Olfr629 UTSW 7 103741112 missense probably benign 0.12
Z1177:Olfr629 UTSW 7 103741068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTTGCAGGCACATTCTTGC -3'
(R):5'- ACGCCCATGGTGATTAAAATAGG -3'

Sequencing Primer
(F):5'- GCACATTCTTGCCAAAACGATGTG -3'
(R):5'- GCCCATGGTGATTAAAATAGGTCTAG -3'
Posted On 2016-07-22