Mutagenetix > Incidental Mutations

Incidental Mutation 'R5321:Tpte'

406111

Institutional Source

Beutler Lab

Gene Symbol

Tpte

Ensembl Gene

ENSMUSG00000031481

Gene Name

transmembrane phosphatase with tensin homology

Synonyms

Pten2

MMRRC Submission

042904-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R5321 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

22283441-22371418 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 22297203 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 33 (R33*)

Ref Sequence

ENSEMBL: ENSMUSP00000147872 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077194] [ENSMUST00000211497] [ENSMUST00000211747]

Predicted Effect

probably null
Transcript: ENSMUST00000077194
AA Change: R33*

SMART Domains

Protein: ENSMUSP00000076435
Gene: ENSMUSG00000031481
AA Change: R33*

Domain	Start	End	E-Value	Type
low complexity region	146	167	N/A	INTRINSIC
transmembrane domain	212	231	N/A	INTRINSIC
transmembrane domain	246	265	N/A	INTRINSIC
transmembrane domain	277	299	N/A	INTRINSIC
low complexity region	307	329	N/A	INTRINSIC
Pfam:Y_phosphatase	369	511	1.4e-6	PFAM
Pfam:DSPc	384	505	7.3e-8	PFAM
PTEN_C2	529	663	3.72e-43	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000211497
AA Change: R33*

Predicted Effect

probably null
Transcript: ENSMUST00000211747
AA Change: R33*

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.7%
20x: 96.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TPIP is a member of a large class of membrane-associated phosphatases with substrate specificity for the 3-position phosphate of inositol phospholipids.[supplied by OMIM, Jul 2002]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	G	11: 110,327,825	F72L	probably benign	Het
Btrc	G	A	19: 45,507,758	V211M	probably damaging	Het
Col6a5	A	T	9: 105,928,465	Y1081N	unknown	Het
Cryzl1	T	C	16: 91,707,230	Y109C	probably benign	Het
Dlec1	T	A	9: 119,112,601	S352T	probably benign	Het
Dzip3	T	G	16: 48,957,675	T349P	possibly damaging	Het
Endou	A	G	15: 97,721,032	V37A	probably damaging	Het
Exosc1	A	T	19: 41,924,060	C129*	probably null	Het
Flywch1	C	G	17: 23,756,651	R539P	probably damaging	Het
Gm14410	G	A	2: 177,193,505	T322I	probably damaging	Het
Gm340	G	T	19: 41,585,204	W799C	probably damaging	Het
Lpin2	G	A	17: 71,246,858	V857M	probably damaging	Het
Olfr629	T	C	7: 103,740,655	N195S	probably damaging	Het
Patl1	A	G	19: 11,921,421	Q160R	probably damaging	Het
Phtf1	C	T	3: 104,003,511	T606I	probably benign	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Scrt1	T	C	15: 76,519,170	S207G	unknown	Het
Slc15a5	G	T	6: 137,987,438	N496K	probably benign	Het
Slc17a2	A	T	13: 23,812,631	I40F	possibly damaging	Het
Tdrd12	A	C	7: 35,478,094	V945G	probably damaging	Het
Tdrkh	C	A	3: 94,425,658	L169I	probably damaging	Het
Tmem59l	A	G	8: 70,487,215	C35R	probably damaging	Het
Trpv2	T	A	11: 62,584,571	L270H	probably damaging	Het
Utp18	A	G	11: 93,866,434	L468P	probably damaging	Het
Uxs1	A	G	1: 43,805,645	I51T	probably damaging	Het
Vmn1r20	C	T	6: 57,432,442	S251L	probably benign	Het
Vmn1r24	A	T	6: 57,956,197	L112*	probably null	Het
Vmn1r5	T	C	6: 56,985,607	L89P	probably damaging	Het
Vmn2r10	G	T	5: 108,995,639	A815E	probably damaging	Het
Zfp119a	A	T	17: 55,865,595	L416H	probably damaging	Het

Other mutations in Tpte

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Tpte	APN	8	22320882	missense	probably benign	0.03
IGL01456:Tpte	APN	8	22345052	splice site	probably benign
IGL01947:Tpte	APN	8	22355473	missense	possibly damaging	0.88
IGL01975:Tpte	APN	8	22349337	missense	probably damaging	1.00
IGL02458:Tpte	APN	8	22305858	missense	probably benign
IGL03411:Tpte	APN	8	22325537	missense	possibly damaging	0.64
R0158:Tpte	UTSW	8	22327739	missense	possibly damaging	0.47
R0396:Tpte	UTSW	8	22335608	splice site	probably benign
R0611:Tpte	UTSW	8	22336533	missense	possibly damaging	0.68
R1481:Tpte	UTSW	8	22355471	missense	probably damaging	1.00
R1489:Tpte	UTSW	8	22349389	critical splice donor site	probably null
R1569:Tpte	UTSW	8	22345031	missense	probably damaging	0.98
R1632:Tpte	UTSW	8	22349347	missense	probably damaging	0.98
R1639:Tpte	UTSW	8	22320897	missense	probably benign	0.00
R2030:Tpte	UTSW	8	22345885	missense	probably damaging	1.00
R2057:Tpte	UTSW	8	22318339	missense	probably benign	0.13
R2519:Tpte	UTSW	8	22333160	splice site	probably benign
R2655:Tpte	UTSW	8	22311278	critical splice acceptor site	probably null
R2884:Tpte	UTSW	8	22335423	nonsense	probably null
R3033:Tpte	UTSW	8	22320872	missense	possibly damaging	0.84
R3734:Tpte	UTSW	8	22359482	missense	probably damaging	1.00
R3961:Tpte	UTSW	8	22359415	missense	probably damaging	0.99
R4050:Tpte	UTSW	8	22365984	missense	probably damaging	1.00
R4591:Tpte	UTSW	8	22327775	missense	probably benign	0.08
R4994:Tpte	UTSW	8	22318346	missense	probably benign	0.23
R5394:Tpte	UTSW	8	22327790	missense	probably damaging	1.00
R5588:Tpte	UTSW	8	22284967	missense	possibly damaging	0.95
R5590:Tpte	UTSW	8	22351452	missense	probably damaging	1.00
R5670:Tpte	UTSW	8	22327748	missense	probably damaging	1.00
R6544:Tpte	UTSW	8	22315105	critical splice donor site	probably null
R6596:Tpte	UTSW	8	22333269	missense	probably damaging	0.99
R6729:Tpte	UTSW	8	22355475	missense	probably damaging	1.00
R7120:Tpte	UTSW	8	22327673	missense	probably damaging	1.00
R7526:Tpte	UTSW	8	22325547	critical splice donor site	probably null
R7575:Tpte	UTSW	8	22355482	missense	probably damaging	1.00
RF006:Tpte	UTSW	8	22306943	missense	probably benign
Z1176:Tpte	UTSW	8	22333193	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTACAGGGCTCTCGATTTTG -3'
(R):5'- TTCTGAGACAGGGCCAGATG -3'

Sequencing Primer
(F):5'- ACAGGGCTCTCGATTTTGAATTC -3'
(R):5'- AAATTTCCCCCTGGTGATGAG -3'

Posted On

2016-07-22