Incidental Mutation 'R5321:Trpv2'
ID406115
Institutional Source Beutler Lab
Gene Symbol Trpv2
Ensembl Gene ENSMUSG00000018507
Gene Nametransient receptor potential cation channel, subfamily V, member 2
SynonymsVrl1, OTRPC2, VRL-1
MMRRC Submission 042904-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.622) question?
Stock #R5321 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location62574486-62600515 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62584571 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 270 (L270H)
Ref Sequence ENSEMBL: ENSMUSP00000099703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018651] [ENSMUST00000102643]
Predicted Effect probably damaging
Transcript: ENSMUST00000018651
AA Change: L270H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018651
Gene: ENSMUSG00000018507
AA Change: L270H

DomainStartEndE-ValueType
Blast:ANK 70 99 2e-8 BLAST
ANK 111 143 9.33e2 SMART
ANK 158 187 1.83e-3 SMART
ANK 204 233 1.46e2 SMART
Blast:ANK 241 274 1e-10 BLAST
ANK 289 319 3.04e0 SMART
Pfam:Ion_trans 387 652 2.3e-12 PFAM
Blast:PHB 674 726 4e-19 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000102643
AA Change: L270H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099703
Gene: ENSMUSG00000018507
AA Change: L270H

DomainStartEndE-ValueType
Blast:ANK 70 99 2e-8 BLAST
ANK 111 143 9.33e2 SMART
ANK 158 187 1.83e-3 SMART
ANK 204 233 1.46e2 SMART
Blast:ANK 241 274 1e-10 BLAST
ANK 289 319 3.04e0 SMART
transmembrane domain 388 410 N/A INTRINSIC
Pfam:Ion_trans 434 640 8.9e-10 PFAM
Blast:PHB 674 726 4e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153486
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ion channel that is activated by high temperatures above 52 degrees Celsius. The protein may be involved in transduction of high-temperature heat responses in sensory ganglia. It is thought that in other tissues the channel may be activated by stimuli other than heat. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired macrophage migration, binding, and phagocytosis with increased susceptiblity and mortality following bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,327,825 F72L probably benign Het
Btrc G A 19: 45,507,758 V211M probably damaging Het
Col6a5 A T 9: 105,928,465 Y1081N unknown Het
Cryzl1 T C 16: 91,707,230 Y109C probably benign Het
Dlec1 T A 9: 119,112,601 S352T probably benign Het
Dzip3 T G 16: 48,957,675 T349P possibly damaging Het
Endou A G 15: 97,721,032 V37A probably damaging Het
Exosc1 A T 19: 41,924,060 C129* probably null Het
Flywch1 C G 17: 23,756,651 R539P probably damaging Het
Gm14410 G A 2: 177,193,505 T322I probably damaging Het
Gm340 G T 19: 41,585,204 W799C probably damaging Het
Lpin2 G A 17: 71,246,858 V857M probably damaging Het
Olfr629 T C 7: 103,740,655 N195S probably damaging Het
Patl1 A G 19: 11,921,421 Q160R probably damaging Het
Phtf1 C T 3: 104,003,511 T606I probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Scrt1 T C 15: 76,519,170 S207G unknown Het
Slc15a5 G T 6: 137,987,438 N496K probably benign Het
Slc17a2 A T 13: 23,812,631 I40F possibly damaging Het
Tdrd12 A C 7: 35,478,094 V945G probably damaging Het
Tdrkh C A 3: 94,425,658 L169I probably damaging Het
Tmem59l A G 8: 70,487,215 C35R probably damaging Het
Tpte A T 8: 22,297,203 R33* probably null Het
Utp18 A G 11: 93,866,434 L468P probably damaging Het
Uxs1 A G 1: 43,805,645 I51T probably damaging Het
Vmn1r20 C T 6: 57,432,442 S251L probably benign Het
Vmn1r24 A T 6: 57,956,197 L112* probably null Het
Vmn1r5 T C 6: 56,985,607 L89P probably damaging Het
Vmn2r10 G T 5: 108,995,639 A815E probably damaging Het
Zfp119a A T 17: 55,865,595 L416H probably damaging Het
Other mutations in Trpv2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Trpv2 APN 11 62592855 missense probably damaging 1.00
IGL02223:Trpv2 APN 11 62581255 missense probably benign 0.00
Playtar UTSW 11 62590260 missense probably damaging 1.00
PIT4576001:Trpv2 UTSW 11 62581201 missense probably damaging 1.00
R0008:Trpv2 UTSW 11 62590260 missense probably damaging 1.00
R0357:Trpv2 UTSW 11 62590304 missense probably damaging 1.00
R0506:Trpv2 UTSW 11 62582906 missense probably benign 0.06
R0586:Trpv2 UTSW 11 62592770 missense probably benign 0.01
R0690:Trpv2 UTSW 11 62584676 critical splice donor site probably null
R1519:Trpv2 UTSW 11 62589826 critical splice donor site probably null
R1556:Trpv2 UTSW 11 62592233 missense probably damaging 1.00
R1770:Trpv2 UTSW 11 62596961 missense probably benign 0.12
R1772:Trpv2 UTSW 11 62594226 splice site probably benign
R2143:Trpv2 UTSW 11 62592786 missense probably benign 0.05
R4743:Trpv2 UTSW 11 62592801 missense probably benign 0.00
R4795:Trpv2 UTSW 11 62581180 missense possibly damaging 0.89
R6856:Trpv2 UTSW 11 62584615 missense probably benign 0.00
R7024:Trpv2 UTSW 11 62584461 missense probably benign 0.03
R7168:Trpv2 UTSW 11 62583088 missense probably benign 0.19
R7488:Trpv2 UTSW 11 62589750 missense probably damaging 1.00
R7633:Trpv2 UTSW 11 62591006 critical splice donor site probably null
R8215:Trpv2 UTSW 11 62590931 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGCTACCTCTTTCTCTGGCAG -3'
(R):5'- GTTGCACTCAGTTAAACAAGGC -3'

Sequencing Primer
(F):5'- TTTCTCTGGCAGCGTGC -3'
(R):5'- TAATGAAGGGTCCAGCGTG -3'
Posted On2016-07-22