Incidental Mutation 'R5321:Utp18'
ID406117
Institutional Source Beutler Lab
Gene Symbol Utp18
Ensembl Gene ENSMUSG00000054079
Gene NameUTP18 small subunit processome component
Synonyms6230425C22Rik, Wdr50
MMRRC Submission 042904-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R5321 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location93859243-93885766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93866434 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 468 (L468P)
Ref Sequence ENSEMBL: ENSMUSP00000068103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066888]
Predicted Effect probably damaging
Transcript: ENSMUST00000066888
AA Change: L468P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000068103
Gene: ENSMUSG00000054079
AA Change: L468P

DomainStartEndE-ValueType
low complexity region 43 64 N/A INTRINSIC
low complexity region 100 111 N/A INTRINSIC
low complexity region 139 146 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
WD40 236 275 7.4e0 SMART
WD40 280 320 3.08e0 SMART
Blast:WD40 325 365 4e-17 BLAST
WD40 368 406 2.23e-1 SMART
WD40 409 449 1.78e0 SMART
WD40 458 499 2.05e1 SMART
WD40 510 545 7.92e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130797
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,327,825 F72L probably benign Het
Btrc G A 19: 45,507,758 V211M probably damaging Het
Col6a5 A T 9: 105,928,465 Y1081N unknown Het
Cryzl1 T C 16: 91,707,230 Y109C probably benign Het
Dlec1 T A 9: 119,112,601 S352T probably benign Het
Dzip3 T G 16: 48,957,675 T349P possibly damaging Het
Endou A G 15: 97,721,032 V37A probably damaging Het
Exosc1 A T 19: 41,924,060 C129* probably null Het
Flywch1 C G 17: 23,756,651 R539P probably damaging Het
Gm14410 G A 2: 177,193,505 T322I probably damaging Het
Gm340 G T 19: 41,585,204 W799C probably damaging Het
Lpin2 G A 17: 71,246,858 V857M probably damaging Het
Olfr629 T C 7: 103,740,655 N195S probably damaging Het
Patl1 A G 19: 11,921,421 Q160R probably damaging Het
Phtf1 C T 3: 104,003,511 T606I probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Scrt1 T C 15: 76,519,170 S207G unknown Het
Slc15a5 G T 6: 137,987,438 N496K probably benign Het
Slc17a2 A T 13: 23,812,631 I40F possibly damaging Het
Tdrd12 A C 7: 35,478,094 V945G probably damaging Het
Tdrkh C A 3: 94,425,658 L169I probably damaging Het
Tmem59l A G 8: 70,487,215 C35R probably damaging Het
Tpte A T 8: 22,297,203 R33* probably null Het
Trpv2 T A 11: 62,584,571 L270H probably damaging Het
Uxs1 A G 1: 43,805,645 I51T probably damaging Het
Vmn1r20 C T 6: 57,432,442 S251L probably benign Het
Vmn1r24 A T 6: 57,956,197 L112* probably null Het
Vmn1r5 T C 6: 56,985,607 L89P probably damaging Het
Vmn2r10 G T 5: 108,995,639 A815E probably damaging Het
Zfp119a A T 17: 55,865,595 L416H probably damaging Het
Other mutations in Utp18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Utp18 APN 11 93869848 missense possibly damaging 0.95
IGL02061:Utp18 APN 11 93882141 missense probably benign 0.05
IGL02402:Utp18 APN 11 93883791 unclassified probably benign
IGL02552:Utp18 APN 11 93868334 missense probably damaging 0.97
IGL03086:Utp18 APN 11 93876056 missense probably damaging 1.00
IGL03090:Utp18 APN 11 93868419 missense probably damaging 1.00
IGL03281:Utp18 APN 11 93875958 missense probably damaging 1.00
R0042:Utp18 UTSW 11 93875858 missense probably damaging 0.99
R0281:Utp18 UTSW 11 93882177 unclassified probably benign
R0399:Utp18 UTSW 11 93880147 splice site probably benign
R0543:Utp18 UTSW 11 93875835 missense probably damaging 1.00
R1512:Utp18 UTSW 11 93885564 missense probably benign 0.00
R1674:Utp18 UTSW 11 93876053 critical splice donor site probably null
R2013:Utp18 UTSW 11 93876122 missense possibly damaging 0.91
R4426:Utp18 UTSW 11 93866438 missense probably damaging 1.00
R4427:Utp18 UTSW 11 93866438 missense probably damaging 1.00
R4455:Utp18 UTSW 11 93885447 missense probably benign 0.09
R4458:Utp18 UTSW 11 93870533 missense possibly damaging 0.92
R5085:Utp18 UTSW 11 93870537 missense possibly damaging 0.78
R5297:Utp18 UTSW 11 93876089 missense probably damaging 0.99
R6006:Utp18 UTSW 11 93885623 missense probably benign 0.00
R6845:Utp18 UTSW 11 93885756 unclassified probably benign
R7211:Utp18 UTSW 11 93885380 missense probably benign 0.01
R7330:Utp18 UTSW 11 93882073 critical splice donor site probably null
R8193:Utp18 UTSW 11 93876077 missense probably damaging 1.00
RF015:Utp18 UTSW 11 93885461 missense probably damaging 1.00
Z1177:Utp18 UTSW 11 93875821 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCACACACTACTATTCTGTTATCAC -3'
(R):5'- AATTGAAAAGCTGCTCGGCC -3'

Sequencing Primer
(F):5'- GTTATCACTCACTGTTTTAACATGAC -3'
(R):5'- CGCGTTGAATTCTTCAGCCATTG -3'
Posted On2016-07-22