Mutagenetix > Incidental Mutation

Incidental Mutation 'R5321:Flywch1'

406125

Institutional Source

Beutler Lab

Gene Symbol

Flywch1

Ensembl Gene

ENSMUSG00000040097

Gene Name

FLYWCH-type zinc finger 1

Synonyms

MMRRC Submission

042904-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5321 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23752793-23771602 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 23756651 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Proline at position 539 (R539P)

Ref Sequence

ENSEMBL: ENSMUSP00000083505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045517] [ENSMUST00000086325]

AlphaFold

Q8CI03

Predicted Effect

probably damaging
Transcript: ENSMUST00000045517
AA Change: R539P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000040022
Gene: ENSMUSG00000040097
AA Change: R539P

Domain	Start	End	E-Value	Type
Pfam:FLYWCH_N	1	83	1.2e-24	PFAM
Pfam:FLYWCH	92	150	7e-17	PFAM
Pfam:FLYWCH	235	293	3.3e-17	PFAM
low complexity region	352	380	N/A	INTRINSIC
low complexity region	381	394	N/A	INTRINSIC
Pfam:FLYWCH	402	460	9.7e-18	PFAM
Pfam:FLYWCH	490	548	7.9e-18	PFAM
Pfam:FLYWCH	581	639	6.1e-17	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000086325
AA Change: R539P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000083505
Gene: ENSMUSG00000040097
AA Change: R539P

Domain	Start	End	E-Value	Type
Pfam:FLYWCH_N	1	84	9.7e-10	PFAM
Pfam:FLYWCH	92	150	3.8e-17	PFAM
Pfam:FLYWCH	235	293	3.1e-17	PFAM
Pfam:FLYWCH_u	294	401	1.3e-30	PFAM
Pfam:FLYWCH	402	460	9.1e-18	PFAM
Pfam:FLYWCH	490	548	6.8e-18	PFAM
Pfam:FLYWCH_u	549	568	9.1e-3	PFAM
Pfam:FLYWCH	581	639	4.7e-17	PFAM
Pfam:FLYWCH_u	640	672	4.6e-4	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181605

Predicted Effect

unknown
Transcript: ENSMUST00000227120
AA Change: R492P

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227733

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.7%
20x: 96.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	G	11: 110,327,825	F72L	probably benign	Het
Btrc	G	A	19: 45,507,758	V211M	probably damaging	Het
Col6a5	A	T	9: 105,928,465	Y1081N	unknown	Het
Cryzl1	T	C	16: 91,707,230	Y109C	probably benign	Het
Dlec1	T	A	9: 119,112,601	S352T	probably benign	Het
Dzip3	T	G	16: 48,957,675	T349P	possibly damaging	Het
Endou	A	G	15: 97,721,032	V37A	probably damaging	Het
Exosc1	A	T	19: 41,924,060	C129*	probably null	Het
Gm14410	G	A	2: 177,193,505	T322I	probably damaging	Het
Gm340	G	T	19: 41,585,204	W799C	probably damaging	Het
Lpin2	G	A	17: 71,246,858	V857M	probably damaging	Het
Olfr629	T	C	7: 103,740,655	N195S	probably damaging	Het
Patl1	A	G	19: 11,921,421	Q160R	probably damaging	Het
Phtf1	C	T	3: 104,003,511	T606I	probably benign	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Scrt1	T	C	15: 76,519,170	S207G	unknown	Het
Slc15a5	G	T	6: 137,987,438	N496K	probably benign	Het
Slc17a2	A	T	13: 23,812,631	I40F	possibly damaging	Het
Tdrd12	A	C	7: 35,478,094	V945G	probably damaging	Het
Tdrkh	C	A	3: 94,425,658	L169I	probably damaging	Het
Tmem59l	A	G	8: 70,487,215	C35R	probably damaging	Het
Tpte	A	T	8: 22,297,203	R33*	probably null	Het
Trpv2	T	A	11: 62,584,571	L270H	probably damaging	Het
Utp18	A	G	11: 93,866,434	L468P	probably damaging	Het
Uxs1	A	G	1: 43,805,645	I51T	probably damaging	Het
Vmn1r20	C	T	6: 57,432,442	S251L	probably benign	Het
Vmn1r24	A	T	6: 57,956,197	L112*	probably null	Het
Vmn1r5	T	C	6: 56,985,607	L89P	probably damaging	Het
Vmn2r10	G	T	5: 108,995,639	A815E	probably damaging	Het
Zfp119a	A	T	17: 55,865,595	L416H	probably damaging	Het

Other mutations in Flywch1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01716:Flywch1	APN	17	23763026	missense	probably benign	0.01
IGL01843:Flywch1	APN	17	23760345	missense	possibly damaging	0.89
IGL02110:Flywch1	APN	17	23763092	splice site	probably null
IGL02586:Flywch1	APN	17	23755702	missense	probably benign	0.04
IGL02870:Flywch1	APN	17	23755902	missense	probably damaging	1.00
IGL02877:Flywch1	APN	17	23760414	missense	probably damaging	1.00
lubdub	UTSW	17	23761059	missense	possibly damaging	0.93
R0830:Flywch1	UTSW	17	23762370	missense	probably benign	0.00
R1411:Flywch1	UTSW	17	23755824	missense	probably damaging	1.00
R2044:Flywch1	UTSW	17	23762313	nonsense	probably null
R2153:Flywch1	UTSW	17	23755650	missense	probably benign	0.21
R2314:Flywch1	UTSW	17	23763026	missense	probably benign	0.01
R2497:Flywch1	UTSW	17	23755711	missense	probably benign	0.27
R3022:Flywch1	UTSW	17	23763108	missense	probably benign	0.00
R3625:Flywch1	UTSW	17	23760201	splice site	probably benign
R3691:Flywch1	UTSW	17	23763212	missense	probably damaging	0.96
R4805:Flywch1	UTSW	17	23760617	missense	probably benign	0.16
R7148:Flywch1	UTSW	17	23755675	missense	probably benign	0.01
R7200:Flywch1	UTSW	17	23761059	missense	possibly damaging	0.93
R7629:Flywch1	UTSW	17	23755770	missense	probably benign	0.06
R8362:Flywch1	UTSW	17	23756708	missense	probably damaging	1.00
R8762:Flywch1	UTSW	17	23756757	missense	probably damaging	1.00
RF003:Flywch1	UTSW	17	23762166	frame shift	probably null
RF007:Flywch1	UTSW	17	23762164	frame shift	probably null
RF007:Flywch1	UTSW	17	23762171	frame shift	probably null
RF009:Flywch1	UTSW	17	23762161	frame shift	probably null
RF010:Flywch1	UTSW	17	23762175	frame shift	probably null
RF013:Flywch1	UTSW	17	23762175	frame shift	probably null
RF018:Flywch1	UTSW	17	23762166	frame shift	probably null
RF022:Flywch1	UTSW	17	23762167	frame shift	probably null
RF027:Flywch1	UTSW	17	23762158	frame shift	probably null
RF031:Flywch1	UTSW	17	23762158	frame shift	probably null
RF038:Flywch1	UTSW	17	23762164	frame shift	probably null
RF040:Flywch1	UTSW	17	23762169	frame shift	probably null
RF041:Flywch1	UTSW	17	23762161	frame shift	probably null
RF041:Flywch1	UTSW	17	23762177	frame shift	probably null
RF046:Flywch1	UTSW	17	23762169	frame shift	probably null
RF046:Flywch1	UTSW	17	23762174	frame shift	probably null
RF049:Flywch1	UTSW	17	23762171	frame shift	probably null
RF058:Flywch1	UTSW	17	23762177	frame shift	probably null
X0009:Flywch1	UTSW	17	23755655	small deletion	probably benign
X0028:Flywch1	UTSW	17	23761095	missense	probably damaging	1.00
Z1176:Flywch1	UTSW	17	23761009	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- GTGACTGACAGCCATACCAC -3'
(R):5'- TTCTTTACAGAAGGGCCTGAG -3'

Sequencing Primer
(F):5'- TAGAGCCAGTGTCTCTTAGCACAG -3'
(R):5'- TGAGTTCCTAAAGACCCCTCTAGGAG -3'

Posted On

2016-07-22