Mutagenetix > Incidental Mutations

Incidental Mutation 'R5321:Lpin2'

406127

Institutional Source

Beutler Lab

Gene Symbol

Lpin2

Ensembl Gene

ENSMUSG00000024052

Gene Name

lipin 2

Synonyms

2610511G02Rik

MMRRC Submission

042904-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.289) question?

Stock #

R5321 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

71182560-71249817 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 71246858 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 857 (V857M)

Ref Sequence

ENSEMBL: ENSMUSP00000119282 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000126681] [ENSMUST00000129635]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000053173

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125665

Predicted Effect

probably damaging
Transcript: ENSMUST00000126681
AA Change: V895M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118610
Gene: ENSMUSG00000024052
AA Change: V895M

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	39	148	1e-47	PFAM
low complexity region	191	206	N/A	INTRINSIC
low complexity region	217	227	N/A	INTRINSIC
low complexity region	398	420	N/A	INTRINSIC
Pfam:Lipin_mid	504	596	6.1e-37	PFAM
LNS2	720	876	2.18e-107	SMART
low complexity region	924	930	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000129635
AA Change: V857M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119282
Gene: ENSMUSG00000024052
AA Change: V857M

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	114	2.2e-53	PFAM
low complexity region	153	168	N/A	INTRINSIC
low complexity region	179	189	N/A	INTRINSIC
low complexity region	360	382	N/A	INTRINSIC
LNS2	682	838	2.18e-107	SMART
low complexity region	886	892	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133156

Predicted Effect

probably benign
Transcript: ENSMUST00000154507

SMART Domains

Protein: ENSMUSP00000127035
Gene: ENSMUSG00000024052

Domain	Start	End	E-Value	Type
Pfam:Lipin_mid	1	55	2.3e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156565

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180743

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.7%
20x: 96.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mouse studies suggest that this gene functions during normal adipose tissue development and may play a role in human triglyceride metabolism. This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop ataxia, impaired blance, and tremors with age and show altered cerebellar phospholipid composition and anemia. Mice show diet-induced hepatic triglyceride accumulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	G	11: 110,327,825	F72L	probably benign	Het
Btrc	G	A	19: 45,507,758	V211M	probably damaging	Het
Col6a5	A	T	9: 105,928,465	Y1081N	unknown	Het
Cryzl1	T	C	16: 91,707,230	Y109C	probably benign	Het
Dlec1	T	A	9: 119,112,601	S352T	probably benign	Het
Dzip3	T	G	16: 48,957,675	T349P	possibly damaging	Het
Endou	A	G	15: 97,721,032	V37A	probably damaging	Het
Exosc1	A	T	19: 41,924,060	C129*	probably null	Het
Flywch1	C	G	17: 23,756,651	R539P	probably damaging	Het
Gm14410	G	A	2: 177,193,505	T322I	probably damaging	Het
Gm340	G	T	19: 41,585,204	W799C	probably damaging	Het
Olfr629	T	C	7: 103,740,655	N195S	probably damaging	Het
Patl1	A	G	19: 11,921,421	Q160R	probably damaging	Het
Phtf1	C	T	3: 104,003,511	T606I	probably benign	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Scrt1	T	C	15: 76,519,170	S207G	unknown	Het
Slc15a5	G	T	6: 137,987,438	N496K	probably benign	Het
Slc17a2	A	T	13: 23,812,631	I40F	possibly damaging	Het
Tdrd12	A	C	7: 35,478,094	V945G	probably damaging	Het
Tdrkh	C	A	3: 94,425,658	L169I	probably damaging	Het
Tmem59l	A	G	8: 70,487,215	C35R	probably damaging	Het
Tpte	A	T	8: 22,297,203	R33*	probably null	Het
Trpv2	T	A	11: 62,584,571	L270H	probably damaging	Het
Utp18	A	G	11: 93,866,434	L468P	probably damaging	Het
Uxs1	A	G	1: 43,805,645	I51T	probably damaging	Het
Vmn1r20	C	T	6: 57,432,442	S251L	probably benign	Het
Vmn1r24	A	T	6: 57,956,197	L112*	probably null	Het
Vmn1r5	T	C	6: 56,985,607	L89P	probably damaging	Het
Vmn2r10	G	T	5: 108,995,639	A815E	probably damaging	Het
Zfp119a	A	T	17: 55,865,595	L416H	probably damaging	Het

Other mutations in Lpin2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Lpin2	APN	17	71243972	missense	probably damaging	1.00
IGL01712:Lpin2	APN	17	71215068	missense	probably damaging	1.00
IGL01727:Lpin2	APN	17	71246452	missense	probably damaging	1.00
IGL01969:Lpin2	APN	17	71231507	missense	probably benign	0.00
IGL02143:Lpin2	APN	17	71243926	missense	probably damaging	1.00
IGL02600:Lpin2	APN	17	71238698	missense	probably damaging	0.99
IGL02931:Lpin2	APN	17	71238683	missense	probably damaging	1.00
aspen	UTSW	17	71243970	nonsense	probably null
R0144:Lpin2	UTSW	17	71225076	missense	probably damaging	1.00
R0165:Lpin2	UTSW	17	71246519	missense	probably damaging	1.00
R0367:Lpin2	UTSW	17	71215022	missense	probably damaging	1.00
R0648:Lpin2	UTSW	17	71229312	missense	probably benign	0.01
R1564:Lpin2	UTSW	17	71225060	missense	probably benign	0.01
R1570:Lpin2	UTSW	17	71245181	nonsense	probably null
R1846:Lpin2	UTSW	17	71225069	missense	probably benign	0.00
R3607:Lpin2	UTSW	17	71229392	missense	probably damaging	1.00
R4006:Lpin2	UTSW	17	71246501	missense	probably damaging	1.00
R4526:Lpin2	UTSW	17	71237378	splice site	probably null
R4705:Lpin2	UTSW	17	71232143	unclassified	probably benign
R4949:Lpin2	UTSW	17	71231339	missense	probably damaging	1.00
R4970:Lpin2	UTSW	17	71231334	missense	probably damaging	0.98
R5099:Lpin2	UTSW	17	71243970	nonsense	probably null
R5100:Lpin2	UTSW	17	71243970	nonsense	probably null
R5101:Lpin2	UTSW	17	71243970	nonsense	probably null
R5152:Lpin2	UTSW	17	71245159	missense	probably damaging	1.00
R5216:Lpin2	UTSW	17	71242760	missense	probably damaging	1.00
R5457:Lpin2	UTSW	17	71243372	missense	probably damaging	1.00
R5695:Lpin2	UTSW	17	71244803	missense	probably damaging	1.00
R5786:Lpin2	UTSW	17	71230273	missense	probably benign	0.03
R5869:Lpin2	UTSW	17	71232276	unclassified	probably benign
R5894:Lpin2	UTSW	17	71246934	missense	probably benign	0.39
R6116:Lpin2	UTSW	17	71243930	missense	probably damaging	1.00
R6253:Lpin2	UTSW	17	71231269	missense	probably damaging	1.00
R6280:Lpin2	UTSW	17	71232248	unclassified	probably benign
R6443:Lpin2	UTSW	17	71241668	missense	probably benign	0.25
R6528:Lpin2	UTSW	17	71244005	missense	probably damaging	1.00
R6634:Lpin2	UTSW	17	71246418	missense	probably damaging	1.00
R6828:Lpin2	UTSW	17	71222128	missense	probably damaging	1.00
R6885:Lpin2	UTSW	17	71215150	missense	probably damaging	1.00
R6930:Lpin2	UTSW	17	71244791	missense	probably damaging	1.00
R7067:Lpin2	UTSW	17	71244858	missense	possibly damaging	0.72
R7583:Lpin2	UTSW	17	71231396	nonsense	probably null
R7806:Lpin2	UTSW	17	71245171	missense	probably damaging	1.00
R7840:Lpin2	UTSW	17	71230274	missense	probably benign	0.14
R8011:Lpin2	UTSW	17	71230375	missense	probably benign	0.43
R8553:Lpin2	UTSW	17	71231237	missense	probably damaging	1.00
Z1176:Lpin2	UTSW	17	71225211	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCCTTGTGGATAGCTGCTTAAG -3'
(R):5'- GGAAAGCAGGTTCCTGACTGTC -3'

Sequencing Primer
(F):5'- TGTGTGTGTGTATCTGAACCC -3'
(R):5'- AGGTTCCTGACTGTCAGCTC -3'

Posted On

2016-07-22