Incidental Mutation 'R5321:Patl1'
ID406128
Institutional Source Beutler Lab
Gene Symbol Patl1
Ensembl Gene ENSMUSG00000046139
Gene Nameprotein associated with topoisomerase II homolog 1 (yeast)
SynonymsPat1b
MMRRC Submission 042904-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.637) question?
Stock #R5321 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location11912399-11945096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11921421 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 160 (Q160R)
Ref Sequence ENSEMBL: ENSMUSP00000060398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061618]
Predicted Effect probably damaging
Transcript: ENSMUST00000061618
AA Change: Q160R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000060398
Gene: ENSMUSG00000046139
AA Change: Q160R

DomainStartEndE-ValueType
SCOP:d1sig__ 8 111 2e-3 SMART
low complexity region 211 228 N/A INTRINSIC
low complexity region 245 276 N/A INTRINSIC
low complexity region 310 339 N/A INTRINSIC
low complexity region 356 380 N/A INTRINSIC
Pfam:PAT1 465 726 1.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198985
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,327,825 F72L probably benign Het
Btrc G A 19: 45,507,758 V211M probably damaging Het
Col6a5 A T 9: 105,928,465 Y1081N unknown Het
Cryzl1 T C 16: 91,707,230 Y109C probably benign Het
Dlec1 T A 9: 119,112,601 S352T probably benign Het
Dzip3 T G 16: 48,957,675 T349P possibly damaging Het
Endou A G 15: 97,721,032 V37A probably damaging Het
Exosc1 A T 19: 41,924,060 C129* probably null Het
Flywch1 C G 17: 23,756,651 R539P probably damaging Het
Gm14410 G A 2: 177,193,505 T322I probably damaging Het
Gm340 G T 19: 41,585,204 W799C probably damaging Het
Lpin2 G A 17: 71,246,858 V857M probably damaging Het
Olfr629 T C 7: 103,740,655 N195S probably damaging Het
Phtf1 C T 3: 104,003,511 T606I probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Scrt1 T C 15: 76,519,170 S207G unknown Het
Slc15a5 G T 6: 137,987,438 N496K probably benign Het
Slc17a2 A T 13: 23,812,631 I40F possibly damaging Het
Tdrd12 A C 7: 35,478,094 V945G probably damaging Het
Tdrkh C A 3: 94,425,658 L169I probably damaging Het
Tmem59l A G 8: 70,487,215 C35R probably damaging Het
Tpte A T 8: 22,297,203 R33* probably null Het
Trpv2 T A 11: 62,584,571 L270H probably damaging Het
Utp18 A G 11: 93,866,434 L468P probably damaging Het
Uxs1 A G 1: 43,805,645 I51T probably damaging Het
Vmn1r20 C T 6: 57,432,442 S251L probably benign Het
Vmn1r24 A T 6: 57,956,197 L112* probably null Het
Vmn1r5 T C 6: 56,985,607 L89P probably damaging Het
Vmn2r10 G T 5: 108,995,639 A815E probably damaging Het
Zfp119a A T 17: 55,865,595 L416H probably damaging Het
Other mutations in Patl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Patl1 APN 19 11929887 missense probably benign
IGL01396:Patl1 APN 19 11923883 missense probably damaging 0.98
IGL02071:Patl1 APN 19 11939690 missense probably damaging 1.00
IGL02239:Patl1 APN 19 11937359 nonsense probably null
IGL02306:Patl1 APN 19 11942886 missense possibly damaging 0.47
IGL02468:Patl1 APN 19 11932210 missense probably damaging 1.00
IGL03193:Patl1 APN 19 11920840 missense possibly damaging 0.49
R0382:Patl1 UTSW 19 11925232 splice site probably null
R1015:Patl1 UTSW 19 11920373 missense probably benign 0.00
R1871:Patl1 UTSW 19 11925232 splice site probably benign
R1969:Patl1 UTSW 19 11921418 missense probably benign
R2012:Patl1 UTSW 19 11939817 missense probably damaging 1.00
R2058:Patl1 UTSW 19 11932147 missense possibly damaging 0.87
R2859:Patl1 UTSW 19 11923831 missense probably damaging 1.00
R4043:Patl1 UTSW 19 11942950 missense probably damaging 1.00
R4079:Patl1 UTSW 19 11931630 missense probably damaging 1.00
R4647:Patl1 UTSW 19 11914434 missense probably damaging 1.00
R4735:Patl1 UTSW 19 11922505 missense probably benign
R4830:Patl1 UTSW 19 11925151 missense probably benign 0.01
R5322:Patl1 UTSW 19 11920859 nonsense probably null
R5460:Patl1 UTSW 19 11935718 missense possibly damaging 0.80
R5855:Patl1 UTSW 19 11921516 missense probably damaging 0.99
R5933:Patl1 UTSW 19 11939772 missense probably benign 0.08
R6020:Patl1 UTSW 19 11937354 missense probably damaging 1.00
R6261:Patl1 UTSW 19 11920331 missense probably damaging 1.00
R6317:Patl1 UTSW 19 11920878 missense probably damaging 1.00
R7040:Patl1 UTSW 19 11929954 missense possibly damaging 0.94
R7387:Patl1 UTSW 19 11933730 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTTAACGCAAAGGAATTTTATGGG -3'
(R):5'- CCAATATCCTGGGCTGTGTAC -3'

Sequencing Primer
(F):5'- GGGAGTGATAAAATTGGTGTATGTAC -3'
(R):5'- ACGTTAATGAAAGGTACCTGTTGG -3'
Posted On2016-07-22