Mutagenetix > Incidental Mutations

Incidental Mutation 'R5321:Exosc1'

406130

Institutional Source

Beutler Lab

Gene Symbol

Exosc1

Ensembl Gene

ENSMUSG00000034321

Gene Name

exosome component 1

Synonyms

MMRRC Submission

042904-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R5321 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

41922980-41933314 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 41924060 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 129 (C129*)

Ref Sequence

ENSEMBL: ENSMUSP00000107751 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075280] [ENSMUST00000112123]

Predicted Effect

probably null
Transcript: ENSMUST00000075280
AA Change: C170*

SMART Domains

Protein: ENSMUSP00000074756
Gene: ENSMUSG00000034321
AA Change: C170*

Domain	Start	End	E-Value	Type
Pfam:ECR1_N	8	44	3.8e-12	PFAM
S1	66	147	3.75e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000112123
AA Change: C129*

SMART Domains

Protein: ENSMUSP00000107751
Gene: ENSMUSG00000034321
AA Change: C129*

Domain	Start	End	E-Value	Type
Pfam:ECR1_N	7	41	3.9e-14	PFAM
Pfam:EXOSC1	64	94	7.9e-10	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.7%
20x: 96.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a core component of the exosome. The mammalian exosome is required for rapid degradation of AU rich element-containing RNAs but not for poly(A) shortening. The association of this protein with the exosome is mediated by protein-protein interactions with ribosomal RNA-processing protein 42 and ribosomal RNA-processing protein 46. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2016]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	G	11: 110,327,825	F72L	probably benign	Het
Btrc	G	A	19: 45,507,758	V211M	probably damaging	Het
Col6a5	A	T	9: 105,928,465	Y1081N	unknown	Het
Cryzl1	T	C	16: 91,707,230	Y109C	probably benign	Het
Dlec1	T	A	9: 119,112,601	S352T	probably benign	Het
Dzip3	T	G	16: 48,957,675	T349P	possibly damaging	Het
Endou	A	G	15: 97,721,032	V37A	probably damaging	Het
Flywch1	C	G	17: 23,756,651	R539P	probably damaging	Het
Gm14410	G	A	2: 177,193,505	T322I	probably damaging	Het
Gm340	G	T	19: 41,585,204	W799C	probably damaging	Het
Lpin2	G	A	17: 71,246,858	V857M	probably damaging	Het
Olfr629	T	C	7: 103,740,655	N195S	probably damaging	Het
Patl1	A	G	19: 11,921,421	Q160R	probably damaging	Het
Phtf1	C	T	3: 104,003,511	T606I	probably benign	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Scrt1	T	C	15: 76,519,170	S207G	unknown	Het
Slc15a5	G	T	6: 137,987,438	N496K	probably benign	Het
Slc17a2	A	T	13: 23,812,631	I40F	possibly damaging	Het
Tdrd12	A	C	7: 35,478,094	V945G	probably damaging	Het
Tdrkh	C	A	3: 94,425,658	L169I	probably damaging	Het
Tmem59l	A	G	8: 70,487,215	C35R	probably damaging	Het
Tpte	A	T	8: 22,297,203	R33*	probably null	Het
Trpv2	T	A	11: 62,584,571	L270H	probably damaging	Het
Utp18	A	G	11: 93,866,434	L468P	probably damaging	Het
Uxs1	A	G	1: 43,805,645	I51T	probably damaging	Het
Vmn1r20	C	T	6: 57,432,442	S251L	probably benign	Het
Vmn1r24	A	T	6: 57,956,197	L112*	probably null	Het
Vmn1r5	T	C	6: 56,985,607	L89P	probably damaging	Het
Vmn2r10	G	T	5: 108,995,639	A815E	probably damaging	Het
Zfp119a	A	T	17: 55,865,595	L416H	probably damaging	Het

Other mutations in Exosc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0931:Exosc1	UTSW	19	41933237	unclassified	probably benign
R1471:Exosc1	UTSW	19	41924718	missense	probably damaging	1.00
R1791:Exosc1	UTSW	19	41928085	missense	probably benign	0.30
R2265:Exosc1	UTSW	19	41931418	missense	probably damaging	0.99
R4845:Exosc1	UTSW	19	41931358	missense	possibly damaging	0.87
R5525:Exosc1	UTSW	19	41924018	missense	probably damaging	1.00
R5875:Exosc1	UTSW	19	41928103	missense	probably damaging	1.00
R6172:Exosc1	UTSW	19	41924003	missense	probably damaging	1.00
R7695:Exosc1	UTSW	19	41928080	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- CCGGCACATTGTTTCAAGAG -3'
(R):5'- CCTTAGAGAAACGTTCCCTTAGTG -3'

Sequencing Primer
(F):5'- TTCAAGAGATGGTTGCCAGC -3'
(R):5'- GTTCCCTTAGTGCTAGAGATGACAC -3'

Posted On

2016-07-22