Incidental Mutation 'R5321:Exosc1'
ID406130
Institutional Source Beutler Lab
Gene Symbol Exosc1
Ensembl Gene ENSMUSG00000034321
Gene Nameexosome component 1
Synonyms
MMRRC Submission 042904-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R5321 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location41922980-41933314 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 41924060 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 129 (C129*)
Ref Sequence ENSEMBL: ENSMUSP00000107751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075280] [ENSMUST00000112123]
Predicted Effect probably null
Transcript: ENSMUST00000075280
AA Change: C170*
SMART Domains Protein: ENSMUSP00000074756
Gene: ENSMUSG00000034321
AA Change: C170*

DomainStartEndE-ValueType
Pfam:ECR1_N 8 44 3.8e-12 PFAM
S1 66 147 3.75e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112123
AA Change: C129*
SMART Domains Protein: ENSMUSP00000107751
Gene: ENSMUSG00000034321
AA Change: C129*

DomainStartEndE-ValueType
Pfam:ECR1_N 7 41 3.9e-14 PFAM
Pfam:EXOSC1 64 94 7.9e-10 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a core component of the exosome. The mammalian exosome is required for rapid degradation of AU rich element-containing RNAs but not for poly(A) shortening. The association of this protein with the exosome is mediated by protein-protein interactions with ribosomal RNA-processing protein 42 and ribosomal RNA-processing protein 46. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,327,825 F72L probably benign Het
Btrc G A 19: 45,507,758 V211M probably damaging Het
Col6a5 A T 9: 105,928,465 Y1081N unknown Het
Cryzl1 T C 16: 91,707,230 Y109C probably benign Het
Dlec1 T A 9: 119,112,601 S352T probably benign Het
Dzip3 T G 16: 48,957,675 T349P possibly damaging Het
Endou A G 15: 97,721,032 V37A probably damaging Het
Flywch1 C G 17: 23,756,651 R539P probably damaging Het
Gm14410 G A 2: 177,193,505 T322I probably damaging Het
Gm340 G T 19: 41,585,204 W799C probably damaging Het
Lpin2 G A 17: 71,246,858 V857M probably damaging Het
Olfr629 T C 7: 103,740,655 N195S probably damaging Het
Patl1 A G 19: 11,921,421 Q160R probably damaging Het
Phtf1 C T 3: 104,003,511 T606I probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Scrt1 T C 15: 76,519,170 S207G unknown Het
Slc15a5 G T 6: 137,987,438 N496K probably benign Het
Slc17a2 A T 13: 23,812,631 I40F possibly damaging Het
Tdrd12 A C 7: 35,478,094 V945G probably damaging Het
Tdrkh C A 3: 94,425,658 L169I probably damaging Het
Tmem59l A G 8: 70,487,215 C35R probably damaging Het
Tpte A T 8: 22,297,203 R33* probably null Het
Trpv2 T A 11: 62,584,571 L270H probably damaging Het
Utp18 A G 11: 93,866,434 L468P probably damaging Het
Uxs1 A G 1: 43,805,645 I51T probably damaging Het
Vmn1r20 C T 6: 57,432,442 S251L probably benign Het
Vmn1r24 A T 6: 57,956,197 L112* probably null Het
Vmn1r5 T C 6: 56,985,607 L89P probably damaging Het
Vmn2r10 G T 5: 108,995,639 A815E probably damaging Het
Zfp119a A T 17: 55,865,595 L416H probably damaging Het
Other mutations in Exosc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0931:Exosc1 UTSW 19 41933237 unclassified probably benign
R1471:Exosc1 UTSW 19 41924718 missense probably damaging 1.00
R1791:Exosc1 UTSW 19 41928085 missense probably benign 0.30
R2265:Exosc1 UTSW 19 41931418 missense probably damaging 0.99
R4845:Exosc1 UTSW 19 41931358 missense possibly damaging 0.87
R5525:Exosc1 UTSW 19 41924018 missense probably damaging 1.00
R5875:Exosc1 UTSW 19 41928103 missense probably damaging 1.00
R6172:Exosc1 UTSW 19 41924003 missense probably damaging 1.00
R7695:Exosc1 UTSW 19 41928080 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCGGCACATTGTTTCAAGAG -3'
(R):5'- CCTTAGAGAAACGTTCCCTTAGTG -3'

Sequencing Primer
(F):5'- TTCAAGAGATGGTTGCCAGC -3'
(R):5'- GTTCCCTTAGTGCTAGAGATGACAC -3'
Posted On2016-07-22