Mutagenetix > Incidental Mutations

Incidental Mutation 'R5321:Btrc'

406131

Institutional Source

Beutler Lab

Gene Symbol

Btrc

Ensembl Gene

ENSMUSG00000025217

Gene Name

beta-transducin repeat containing protein

Synonyms

beta-TrCP, Fbw1a, SCF b-TRCP, Slimb, Beta-Trcp1

MMRRC Submission

042904-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5321 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

45363734-45530013 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 45507758 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 211 (V211M)

Ref Sequence

ENSEMBL: ENSMUSP00000070728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065601] [ENSMUST00000111936] [ENSMUST00000223684] [ENSMUST00000223764] [ENSMUST00000224478]

Predicted Effect

probably damaging
Transcript: ENSMUST00000065601
AA Change: V211M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000070728
Gene: ENSMUSG00000025217
AA Change: V211M

Domain	Start	End	E-Value	Type
Beta-TrCP_D	138	177	3.32e-25	SMART
FBOX	189	228	5.83e-6	SMART
WD40	292	329	7.92e-3	SMART
WD40	332	369	8.68e-9	SMART
WD40	372	409	5.31e-4	SMART
WD40	415	452	5.18e-7	SMART
WD40	455	492	3.93e-7	SMART
WD40	495	532	8.42e-7	SMART
WD40	544	581	4.62e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111936
AA Change: V175M

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000107567
Gene: ENSMUSG00000025217
AA Change: V175M

Domain	Start	End	E-Value	Type
Beta-TrCP_D	102	141	3.32e-25	SMART
FBOX	153	192	5.83e-6	SMART
WD40	256	293	7.92e-3	SMART
WD40	296	333	8.68e-9	SMART
WD40	336	373	5.31e-4	SMART
WD40	379	416	5.18e-7	SMART
WD40	419	456	3.93e-7	SMART
WD40	459	496	8.42e-7	SMART
WD40	508	545	4.62e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000223684

Predicted Effect

probably benign
Transcript: ENSMUST00000223764

Predicted Effect

probably damaging
Transcript: ENSMUST00000224478
AA Change: V112M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225662

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.7%
20x: 96.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbws class; in addition to an F-box, this protein contains multiple WD-40 repeats. The encoded protein mediates degradation of CD4 via its interaction with HIV-1 Vpu. It has also been shown to ubiquitinate phosphorylated NFKBIA (nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha), targeting it for degradation and thus activating nuclear factor kappa-B. Alternatively spliced transcript variants have been described. A related pseudogene exists in chromosome 6. [provided by RefSeq, Mar 2012]
PHENOTYPE: Embryonic fibroblasts from homozygotes show an increase in polyploidy and apoptosis and decreased cell proliferation. In a second allele, homozygous mutation results in reduced male fertility and abnormal male meiosis with oligozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	G	11: 110,327,825	F72L	probably benign	Het
Col6a5	A	T	9: 105,928,465	Y1081N	unknown	Het
Cryzl1	T	C	16: 91,707,230	Y109C	probably benign	Het
Dlec1	T	A	9: 119,112,601	S352T	probably benign	Het
Dzip3	T	G	16: 48,957,675	T349P	possibly damaging	Het
Endou	A	G	15: 97,721,032	V37A	probably damaging	Het
Exosc1	A	T	19: 41,924,060	C129*	probably null	Het
Flywch1	C	G	17: 23,756,651	R539P	probably damaging	Het
Gm14410	G	A	2: 177,193,505	T322I	probably damaging	Het
Gm340	G	T	19: 41,585,204	W799C	probably damaging	Het
Lpin2	G	A	17: 71,246,858	V857M	probably damaging	Het
Olfr629	T	C	7: 103,740,655	N195S	probably damaging	Het
Patl1	A	G	19: 11,921,421	Q160R	probably damaging	Het
Phtf1	C	T	3: 104,003,511	T606I	probably benign	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Scrt1	T	C	15: 76,519,170	S207G	unknown	Het
Slc15a5	G	T	6: 137,987,438	N496K	probably benign	Het
Slc17a2	A	T	13: 23,812,631	I40F	possibly damaging	Het
Tdrd12	A	C	7: 35,478,094	V945G	probably damaging	Het
Tdrkh	C	A	3: 94,425,658	L169I	probably damaging	Het
Tmem59l	A	G	8: 70,487,215	C35R	probably damaging	Het
Tpte	A	T	8: 22,297,203	R33*	probably null	Het
Trpv2	T	A	11: 62,584,571	L270H	probably damaging	Het
Utp18	A	G	11: 93,866,434	L468P	probably damaging	Het
Uxs1	A	G	1: 43,805,645	I51T	probably damaging	Het
Vmn1r20	C	T	6: 57,432,442	S251L	probably benign	Het
Vmn1r24	A	T	6: 57,956,197	L112*	probably null	Het
Vmn1r5	T	C	6: 56,985,607	L89P	probably damaging	Het
Vmn2r10	G	T	5: 108,995,639	A815E	probably damaging	Het
Zfp119a	A	T	17: 55,865,595	L416H	probably damaging	Het

Other mutations in Btrc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Btrc	APN	19	45527265	missense	probably damaging	0.99
IGL01691:Btrc	APN	19	45512678	missense	probably benign	0.00
IGL02551:Btrc	APN	19	45423134	missense	possibly damaging	0.83
IGL02719:Btrc	APN	19	45503150	missense	probably damaging	1.00
IGL02852:Btrc	APN	19	45512656	nonsense	probably null
IGL03128:Btrc	APN	19	45513520	missense	probably damaging	1.00
IGL03267:Btrc	APN	19	45518823	missense	probably damaging	1.00
R0145:Btrc	UTSW	19	45423173	missense	probably damaging	0.97
R0750:Btrc	UTSW	19	45503146	missense	probably damaging	1.00
R1466:Btrc	UTSW	19	45513382	splice site	probably benign
R1584:Btrc	UTSW	19	45513382	splice site	probably benign
R1772:Btrc	UTSW	19	45512661	missense	probably damaging	0.98
R1882:Btrc	UTSW	19	45527400	missense	probably damaging	1.00
R1959:Btrc	UTSW	19	45527343	missense	probably damaging	1.00
R1961:Btrc	UTSW	19	45527343	missense	probably damaging	1.00
R2483:Btrc	UTSW	19	45516058	missense	probably damaging	1.00
R4365:Btrc	UTSW	19	45513480	missense	probably damaging	1.00
R4812:Btrc	UTSW	19	45423164	missense	possibly damaging	0.83
R4883:Btrc	UTSW	19	45456587	missense	probably benign	0.09
R7203:Btrc	UTSW	19	45513528	splice site	probably null
R7528:Btrc	UTSW	19	45503086	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TGTTTGAGCAAAGCTGGACC -3'
(R):5'- TACAGACGATGCGCAGTGAC -3'

Sequencing Primer
(F):5'- AAAGCTGGACCACGCTG -3'
(R):5'- TGGCTCCTGACACTTGGC -3'

Posted On

2016-07-22