Incidental Mutation 'R4676:Ano10'
ID406135
Institutional Source Beutler Lab
Gene Symbol Ano10
Ensembl Gene ENSMUSG00000037949
Gene Nameanoctamin 10
SynonymsTmem16k
MMRRC Submission 042013-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R4676 (G1)
Quality Score206
Status Validated
Chromosome9
Chromosomal Location122175874-122294423 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122263787 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 159 (R159G)
Ref Sequence ENSEMBL: ENSMUSP00000149772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042546] [ENSMUST00000214283] [ENSMUST00000214409] [ENSMUST00000214507] [ENSMUST00000216081] [ENSMUST00000216670]
Predicted Effect probably damaging
Transcript: ENSMUST00000042546
AA Change: R159G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045214
Gene: ENSMUSG00000037949
AA Change: R159G

DomainStartEndE-ValueType
Pfam:Anoctamin 200 628 2.2e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214283
AA Change: R159G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000214409
AA Change: R159G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000214507
Predicted Effect probably benign
Transcript: ENSMUST00000216081
Predicted Effect probably damaging
Transcript: ENSMUST00000216670
AA Change: R159G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.2572 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: This gene encodes a member of the anoctamin family, which in mammals is comprised of 10 members. Anoctamin proteins are proposed to have eight transmembrane domains with both termini facing the cytoplasm and a C-terminal domain of unknown function. While some members have been characterized as calcium-activated chloride channels, this protein is reported to inhibit anion conductance. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele fail to exhibit calcium-activated chloride ion secretion in the jejunum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T A 1: 120,150,652 I13N probably damaging Het
Abcd3 T A 3: 121,774,166 T409S possibly damaging Het
Acad12 C A 5: 121,607,171 W317L probably damaging Het
Acap1 T A 11: 69,889,468 M50L probably benign Het
Acvr1b T A 15: 101,202,986 V343E probably damaging Het
Adgb C A 10: 10,426,710 G371W probably damaging Het
AF529169 A G 9: 89,601,553 V597A probably damaging Het
Akap9 A G 5: 4,032,774 K1966R probably damaging Het
Akap9 C T 5: 4,064,515 Q48* probably null Het
Anxa7 T C 14: 20,467,915 M128V probably benign Het
Arhgef40 C A 14: 51,990,959 C554* probably null Het
Asna1 C T 8: 85,018,873 A219T probably benign Het
Atf6 T C 1: 170,787,410 Y538C probably damaging Het
Atp8b1 A C 18: 64,538,678 D1091E probably benign Het
BC034090 A G 1: 155,226,264 Y85H possibly damaging Het
BC067074 C A 13: 113,368,807 L2157I probably damaging Het
BC067074 T G 13: 113,368,808 L2157R probably damaging Het
Bcas2 A G 3: 103,175,701 probably benign Het
Bnc2 T C 4: 84,292,819 N463D probably damaging Het
Capn7 A T 14: 31,359,259 H411L possibly damaging Het
Cavin3 T C 7: 105,481,113 E164G probably damaging Het
Ccdc191 T C 16: 43,939,173 probably benign Het
Ccdc88b A G 19: 6,853,000 V858A probably benign Het
Clcn3 A G 8: 60,930,651 probably benign Het
Commd6 T C 14: 101,640,284 probably benign Het
Cul3 G A 1: 80,271,674 L561F probably damaging Het
Cyfip1 T A 7: 55,875,013 I131N probably damaging Het
Dlgap3 T A 4: 127,233,761 Y741N probably damaging Het
Dnah5 A T 15: 28,295,260 I1380F possibly damaging Het
Dync1h1 G T 12: 110,662,541 L4177F probably damaging Het
Ethe1 G A 7: 24,607,894 V178M probably damaging Het
Flnc A T 6: 29,445,154 probably null Het
Glt8d1 T C 14: 31,006,692 F26L probably benign Het
Gm5493 T A 17: 22,748,081 D63E probably benign Het
Gm9996 T A 10: 29,143,838 probably benign Het
Gnl2 T G 4: 125,053,473 S629R possibly damaging Het
Gpbp1l1 T C 4: 116,590,265 S381P probably damaging Het
Igsf10 A C 3: 59,325,949 F1788V probably benign Het
Inpp5d C A 1: 87,715,142 P935Q probably damaging Het
Itch A C 2: 155,199,435 I468L probably benign Het
Itga5 A T 15: 103,357,210 Y192N probably damaging Het
Itih3 T A 14: 30,918,949 Q302L probably null Het
Itih3 T A 14: 30,921,686 Q121L possibly damaging Het
Kctd17 T A 15: 78,435,759 probably benign Het
Lsm1 T C 8: 25,793,689 L43P probably damaging Het
Magi3 A T 3: 104,015,825 M1192K probably benign Het
Mecom A G 3: 30,268,668 probably benign Het
Mtmr3 A T 11: 4,527,855 F63Y probably benign Het
Naa16 A G 14: 79,336,348 probably benign Het
Neto1 A T 18: 86,398,302 T45S possibly damaging Het
Nlrp4a A T 7: 26,450,229 R420S probably damaging Het
Nr1h4 T C 10: 89,473,874 D317G probably damaging Het
Olfr1497 T A 19: 13,795,474 I46F possibly damaging Het
Olfr1504 C T 19: 13,887,401 D270N probably damaging Het
Olfr920 A G 9: 38,755,659 probably benign Het
Pde5a A T 3: 122,747,893 M11L possibly damaging Het
Plxnb1 G A 9: 109,110,435 R1416Q possibly damaging Het
Polm A T 11: 5,835,749 Y141* probably null Het
Rxfp1 A G 3: 79,705,668 F32L probably damaging Het
Scrt1 T A 15: 76,521,668 D13V possibly damaging Het
Slc1a7 T A 4: 107,977,674 V79E possibly damaging Het
Snurf T C 7: 59,995,522 Q48R probably benign Het
Srek1 T C 13: 103,758,187 probably benign Het
Stxbp5l T C 16: 37,255,884 S267G probably damaging Het
Taf5 C T 19: 47,074,970 R320W probably damaging Het
Tars2 A T 3: 95,753,091 N106K probably damaging Het
Tatdn3 A T 1: 191,049,334 L207Q probably damaging Het
Tdrd6 T C 17: 43,627,610 E849G probably damaging Het
Tedc2 T C 17: 24,220,011 T111A probably benign Het
Tfg T A 16: 56,694,491 probably null Het
Tgds A T 14: 118,116,231 S225T probably benign Het
Tnks2 T A 19: 36,875,271 Y134* probably null Het
Trappc1 T A 11: 69,325,530 V134D probably damaging Het
Ttc3 C A 16: 94,442,761 P853Q probably damaging Het
Ttc7 C A 17: 87,370,735 probably benign Het
Ttf1 A G 2: 29,074,594 S643G probably damaging Het
Tubgcp3 A T 8: 12,650,171 S338T probably damaging Het
Ugt1a6a T C 1: 88,139,285 I271T possibly damaging Het
Vipas39 T A 12: 87,241,301 Y445F probably damaging Het
Vmn1r31 A C 6: 58,472,013 I289S probably damaging Het
Wdr92 T C 11: 17,229,794 V265A probably benign Het
Zfp112 A G 7: 24,126,260 E551G probably damaging Het
Zfp397 T A 18: 23,960,797 Y446* probably null Het
Zfp442 A T 2: 150,409,606 H124Q probably damaging Het
Other mutations in Ano10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Ano10 APN 9 122261356 missense possibly damaging 0.96
IGL00886:Ano10 APN 9 122271324 missense probably benign 0.01
IGL00932:Ano10 APN 9 122251231 nonsense probably null
IGL01613:Ano10 APN 9 122259540 missense possibly damaging 0.75
IGL02109:Ano10 APN 9 122261342 missense probably damaging 1.00
IGL02397:Ano10 APN 9 122261392 missense probably damaging 1.00
IGL02512:Ano10 APN 9 122272474 missense possibly damaging 0.50
IGL03216:Ano10 APN 9 122257061 missense probably damaging 1.00
arna UTSW 9 122259564 missense possibly damaging 0.77
R0624:Ano10 UTSW 9 122259595 splice site probably benign
R1669:Ano10 UTSW 9 122257183 missense possibly damaging 0.94
R1801:Ano10 UTSW 9 122253030 missense probably damaging 1.00
R2511:Ano10 UTSW 9 122258945 missense probably damaging 0.99
R3836:Ano10 UTSW 9 122263763 missense possibly damaging 0.58
R4027:Ano10 UTSW 9 122252928 splice site probably benign
R4151:Ano10 UTSW 9 122261535 nonsense probably null
R4590:Ano10 UTSW 9 122257165 missense probably benign 0.22
R4651:Ano10 UTSW 9 122261115 nonsense probably null
R4652:Ano10 UTSW 9 122261115 nonsense probably null
R5026:Ano10 UTSW 9 122272559 nonsense probably null
R5281:Ano10 UTSW 9 122261486 missense probably damaging 1.00
R5401:Ano10 UTSW 9 122261290 missense probably damaging 1.00
R6269:Ano10 UTSW 9 122261242 missense probably damaging 0.99
R6449:Ano10 UTSW 9 122201688 intron probably benign
R6702:Ano10 UTSW 9 122259564 missense possibly damaging 0.77
R7010:Ano10 UTSW 9 122253124 missense probably damaging 1.00
R7384:Ano10 UTSW 9 122176343 missense unknown
R7584:Ano10 UTSW 9 122275531 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCTAAGCACTGGCAGGAAAG -3'
(R):5'- GTACTGCTTTCATAGTGAGAGAAC -3'

Sequencing Primer
(F):5'- CTGGCAGGAAAGCACTGATCC -3'
(R):5'- TACATCGTCCACGTTCAG -3'
Posted On2016-07-28