Incidental Mutation 'R4807:Arl6ip1'
ID406148
Institutional Source Beutler Lab
Gene Symbol Arl6ip1
Ensembl Gene ENSMUSG00000030654
Gene NameADP-ribosylation factor-like 6 interacting protein 1
SynonymsAIP-6, ARMER
MMRRC Submission 042426-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4807 (G1)
Quality Score217
Status Validated
Chromosome7
Chromosomal Location118118891-118129662 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) AAAATAAATAAATAAATAAATAAATA to AAAATAAATAAATAAATAAATAAATAAATA at 118121899 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032888] [ENSMUST00000203154] [ENSMUST00000204005] [ENSMUST00000206491]
Predicted Effect probably benign
Transcript: ENSMUST00000032888
SMART Domains Protein: ENSMUSP00000032888
Gene: ENSMUSG00000030654

DomainStartEndE-ValueType
transmembrane domain 42 61 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 136 153 N/A INTRINSIC
transmembrane domain 158 180 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203154
Predicted Effect probably benign
Transcript: ENSMUST00000204005
SMART Domains Protein: ENSMUSP00000145418
Gene: ENSMUSG00000030654

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205182
Predicted Effect probably benign
Transcript: ENSMUST00000206491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206536
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ARL6ip family and encodes a transmembrane protein that is predominantly localized to intracytoplasmic membranes. It is highly expressed in early myeloid progenitor cells and thought to be involved in protein transport, membrane trafficking, or cell signaling during hematopoietic maturation. Mutations in this gene are associated with spastic paraplegia 61 (SPG61). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 C T 7: 120,540,609 A1499V probably damaging Het
Agap3 T A 5: 24,477,116 D386E probably damaging Het
Ahdc1 C A 4: 133,064,313 T955K possibly damaging Het
Ankrd9 A G 12: 110,977,235 Y122H probably benign Het
Apc2 G T 10: 80,314,362 R1721L probably benign Het
Arfgef3 A G 10: 18,646,637 V547A probably benign Het
Arhgap42 T C 9: 9,046,628 N203D possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Aspm T A 1: 139,477,919 F1515I probably damaging Het
Baz1a T C 12: 54,898,482 T1363A probably benign Het
Cacng3 C T 7: 122,754,509 A72V probably benign Het
Casp8ap2 T C 4: 32,644,505 C1193R possibly damaging Het
Ccr3 A G 9: 124,029,297 Y223C probably damaging Het
Clcn3 C A 8: 60,934,530 L201F probably damaging Het
Cltc A C 11: 86,701,076 probably benign Het
Cyp19a1 G T 9: 54,176,646 T86K possibly damaging Het
Ddx24 A T 12: 103,419,461 F248L probably damaging Het
Ddx60 G A 8: 61,979,338 V885I probably damaging Het
Dync2h1 T C 9: 7,139,422 I1404M probably benign Het
Emilin2 A T 17: 71,273,448 V761E probably damaging Het
Endou C T 15: 97,731,232 C13Y probably benign Het
Ep400 C A 5: 110,695,578 probably null Het
Fbxo33 C A 12: 59,219,212 D90Y probably damaging Het
Fryl A G 5: 73,041,362 F2641L probably benign Het
Gbp2b A G 3: 142,598,245 I34V probably benign Het
Ghdc T C 11: 100,770,225 H38R probably damaging Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gpr63 A C 4: 25,007,446 M57L probably benign Het
Gprc5c A G 11: 114,864,498 S3G probably damaging Het
Grk4 A T 5: 34,752,208 M539L probably benign Het
Gulo C T 14: 65,990,384 M366I probably benign Het
Heatr5a T C 12: 51,877,520 H1970R probably damaging Het
Hmbox1 T C 14: 64,825,549 probably benign Het
Ighg2b T C 12: 113,304,345 probably benign Het
Il1b A T 2: 129,370,306 C9S probably benign Het
Itpkb A T 1: 180,334,875 probably benign Het
Kcnn1 T A 8: 70,848,178 H473L probably damaging Het
Kidins220 C T 12: 25,057,285 S1579L probably damaging Het
Kif1b A T 4: 149,247,921 probably benign Het
Lyg2 A T 1: 37,911,067 M60K possibly damaging Het
Mak16 G T 8: 31,166,133 H107Q probably benign Het
Mapkap1 G A 2: 34,597,422 probably null Het
Mastl A G 2: 23,132,843 S623P probably benign Het
Mccc1 T C 3: 35,985,046 Y46C probably damaging Het
Mdn1 T G 4: 32,685,651 probably null Het
Med25 T A 7: 44,884,619 T31S probably benign Het
Mprip G A 11: 59,758,020 G850D probably benign Het
Mrpl10 T C 11: 97,041,623 I8T probably benign Het
Msr1 T C 8: 39,642,627 probably benign Het
Myo3b T A 2: 70,105,712 I99N probably damaging Het
Neurod6 A T 6: 55,678,655 N332K probably damaging Het
Npc1l1 T C 11: 6,218,723 Y886C probably damaging Het
Nsmaf T C 4: 6,398,542 probably null Het
Ntn4 C T 10: 93,644,500 R29C probably damaging Het
Olfr74 T A 2: 87,973,751 I305L probably benign Het
Plppr2 A G 9: 21,944,514 N261S probably damaging Het
Prkar2a T A 9: 108,740,385 probably benign Het
Pxk G A 14: 8,144,133 V294M probably damaging Het
Rars A G 11: 35,809,146 F608L possibly damaging Het
Rasa3 A G 8: 13,614,633 F60L probably damaging Het
Rbm47 C T 5: 66,019,304 A490T possibly damaging Het
Sardh T C 2: 27,189,527 I918V probably benign Het
Sdhc T C 1: 171,136,057 Y80C probably damaging Het
Selp T A 1: 164,143,936 M653K probably damaging Het
Slc6a17 T C 3: 107,500,487 D56G possibly damaging Het
Slco1b2 T C 6: 141,669,469 S367P probably damaging Het
Spry4 TTGAGGTCC T 18: 38,590,275 probably null Het
Strip2 T A 6: 29,925,093 Y143* probably null Het
Sycp2 T C 2: 178,393,961 probably benign Het
Tex30 C A 1: 44,086,958 V204L possibly damaging Het
Tex45 A G 8: 3,479,004 K193R possibly damaging Het
Tln2 G T 9: 67,331,733 T1087K probably benign Het
Tmeff2 A C 1: 50,979,387 N176T probably benign Het
Togaram2 C G 17: 71,697,923 T324R probably damaging Het
Trpc3 C T 3: 36,634,382 R836Q probably benign Het
Trpm7 A C 2: 126,831,229 L535V probably benign Het
Vmn1r213 G A 13: 23,011,605 W119* probably null Het
Vps29 T G 5: 122,362,888 V176G probably damaging Het
Vsig10l A G 7: 43,463,749 T144A possibly damaging Het
Wdr11 T C 7: 129,628,022 Y844H probably benign Het
Zbp1 A T 2: 173,212,206 M174K probably damaging Het
Zfp341 G A 2: 154,645,866 probably benign Het
Zfp638 G A 6: 83,943,058 R546H probably damaging Het
Zfp820 A T 17: 21,823,872 M1K probably null Het
Other mutations in Arl6ip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1412:Arl6ip1 UTSW 7 118120368 missense possibly damaging 0.96
R4155:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4156:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4157:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4201:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4206:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4271:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4276:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4277:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4278:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4280:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4281:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4283:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4330:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4502:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4503:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4547:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4548:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4580:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4604:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4774:Arl6ip1 UTSW 7 118121985 missense probably damaging 1.00
R4804:Arl6ip1 UTSW 7 118129552 utr 5 prime probably null
R4805:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R6211:Arl6ip1 UTSW 7 118127250 missense probably benign 0.44
R6651:Arl6ip1 UTSW 7 118129485 missense probably benign 0.00
R7548:Arl6ip1 UTSW 7 118126510 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTACCTTCCCAGTTAGCAC -3'
(R):5'- GGAGGTCAAGAGTCTTAGCTGTC -3'

Sequencing Primer
(F):5'- CCAGTTAGCACTTCCCACC -3'
(R):5'- GTGGAAACGCCTCTTTTC -3'
Posted On2016-08-01