Incidental Mutation 'R0498:Izumo4'
ID40616
Institutional Source Beutler Lab
Gene Symbol Izumo4
Ensembl Gene ENSMUSG00000055862
Gene NameIZUMO family member 4
Synonyms
MMRRC Submission 038694-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0498 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80702184-80705373 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 80704196 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003438] [ENSMUST00000020420] [ENSMUST00000218090] [ENSMUST00000218184] [ENSMUST00000218610]
Predicted Effect probably benign
Transcript: ENSMUST00000003438
SMART Domains Protein: ENSMUSP00000003438
Gene: ENSMUSG00000003348

DomainStartEndE-ValueType
Mob1_phocein 34 208 6.02e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000020420
SMART Domains Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198

DomainStartEndE-ValueType
Pfam:Adaptin_N 32 583 6.6e-153 PFAM
Pfam:Cnd1 130 292 2.1e-8 PFAM
low complexity region 629 642 N/A INTRINSIC
BLVR 660 803 5.3e-80 SMART
low complexity region 835 861 N/A INTRINSIC
low complexity region 871 881 N/A INTRINSIC
coiled coil region 910 933 N/A INTRINSIC
low complexity region 947 964 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000095426
SMART Domains Protein: ENSMUSP00000093076
Gene: ENSMUSG00000055862

DomainStartEndE-ValueType
Pfam:IZUMO 26 167 1.1e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000095426
SMART Domains Protein: ENSMUSP00000093076
Gene: ENSMUSG00000055862

DomainStartEndE-ValueType
Pfam:IZUMO 26 167 1.1e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218058
Predicted Effect probably benign
Transcript: ENSMUST00000218090
Predicted Effect probably null
Transcript: ENSMUST00000218184
Predicted Effect probably benign
Transcript: ENSMUST00000218330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218538
Predicted Effect probably benign
Transcript: ENSMUST00000218610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219987
Meta Mutation Damage Score 0.9576 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,294 D220V probably benign Het
4933406M09Rik A G 1: 134,390,872 I461V possibly damaging Het
6720489N17Rik T C 13: 62,607,387 N39S probably damaging Het
Adgrf2 A G 17: 42,714,315 probably benign Het
Aldh18a1 A G 19: 40,574,272 V219A probably benign Het
Anapc10 A G 8: 79,774,981 D126G probably benign Het
Ap1m2 T C 9: 21,295,833 *426W probably null Het
Arhgap21 A G 2: 20,863,117 I865T probably damaging Het
Armc8 A G 9: 99,497,292 V527A probably damaging Het
Asic5 A T 3: 82,006,471 probably benign Het
Baz2b A C 2: 59,901,996 probably benign Het
Bpifa5 T C 2: 154,167,249 V237A probably damaging Het
Brip1 T A 11: 86,197,919 K52I possibly damaging Het
Cacna1g T C 11: 94,459,859 I387V probably damaging Het
Cbr4 A G 8: 61,495,073 I135V probably benign Het
Ccdc66 C T 14: 27,500,240 probably null Het
Cubn G A 2: 13,444,267 T999M probably damaging Het
Dpp8 C T 9: 65,045,795 probably benign Het
Dsg1b T C 18: 20,409,333 S966P possibly damaging Het
Erp27 T C 6: 136,919,864 probably benign Het
Fat4 A T 3: 38,980,637 I2813L probably benign Het
Fhod1 G A 8: 105,329,856 R1101C probably damaging Het
Hoxc9 T C 15: 102,983,927 S191P probably damaging Het
Kalrn C T 16: 34,054,891 D104N possibly damaging Het
Kank4 A T 4: 98,779,636 D191E probably benign Het
Kbtbd11 A G 8: 15,027,605 E68G probably benign Het
Kdr C T 5: 75,959,138 V654I probably benign Het
Klra1 A T 6: 130,372,819 probably null Het
Kmt2e T A 5: 23,478,972 Y373* probably null Het
Lepr A T 4: 101,745,692 M226L probably benign Het
Lrp1b T A 2: 41,458,405 I800F probably benign Het
Lta4h T C 10: 93,471,971 probably benign Het
Map3k7 T C 4: 31,974,814 probably benign Het
Map4k4 G A 1: 39,990,178 R371Q probably benign Het
Mme A G 3: 63,346,066 I444V probably damaging Het
Mms19 C T 19: 41,949,773 R582Q possibly damaging Het
Mtss1 A G 15: 58,945,437 S502P probably damaging Het
Myo3a G T 2: 22,577,429 A232S possibly damaging Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr727 A C 14: 50,127,293 T239P probably damaging Het
Olfr874 G A 9: 37,746,254 G40E probably damaging Het
Pcm1 G A 8: 41,293,769 S1335N probably benign Het
Pdzph1 A G 17: 58,973,830 F486L probably benign Het
Piezo2 T C 18: 63,102,174 K552R possibly damaging Het
Plekhs1 T A 19: 56,481,104 probably null Het
Pprc1 C T 19: 46,071,568 Q1514* probably null Het
Ralgapa1 T C 12: 55,689,791 T1831A possibly damaging Het
Rnpep G T 1: 135,265,352 D455E probably damaging Het
Rpgrip1 T A 14: 52,131,314 probably benign Het
Saxo1 A T 4: 86,478,896 M135K possibly damaging Het
Serpina12 T C 12: 104,035,789 T223A probably damaging Het
Serpinb3a A G 1: 107,047,150 F218L probably damaging Het
Serpinb9f T G 13: 33,326,007 probably benign Het
Spata33 A G 8: 123,221,923 D98G probably benign Het
Stard13 T A 5: 151,052,477 Y742F probably damaging Het
Tcrg-C3 T A 13: 19,261,092 M70K probably damaging Het
Tecta A G 9: 42,377,614 Y552H probably damaging Het
Tie1 A T 4: 118,479,161 probably benign Het
Tmem161a A G 8: 70,180,973 T254A probably benign Het
Tmem30a G T 9: 79,774,094 Y264* probably null Het
Tmem87a A T 2: 120,394,465 I105K probably benign Het
Tnrc6b A T 15: 80,858,719 D51V probably damaging Het
Trpc4 T C 3: 54,291,211 F519L probably damaging Het
Ttn T C 2: 76,709,581 T26027A probably damaging Het
Vmn1r198 A C 13: 22,354,974 H121P probably damaging Het
Vps33a A G 5: 123,570,961 F64L probably benign Het
Wdr63 G T 3: 146,081,364 D305E possibly damaging Het
Zfp994 A T 17: 22,200,901 C356S probably damaging Het
Other mutations in Izumo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02850:Izumo4 APN 10 80704198 unclassified probably benign
IGL03019:Izumo4 APN 10 80703846 unclassified probably benign
IGL03391:Izumo4 APN 10 80705113 missense probably damaging 0.97
F5770:Izumo4 UTSW 10 80703891 missense probably benign 0.02
IGL02835:Izumo4 UTSW 10 80705125 missense probably benign
R0304:Izumo4 UTSW 10 80702936 missense probably damaging 1.00
R0377:Izumo4 UTSW 10 80702840 missense probably damaging 1.00
R0411:Izumo4 UTSW 10 80703084 missense probably damaging 0.99
R1822:Izumo4 UTSW 10 80703895 missense probably damaging 1.00
R1870:Izumo4 UTSW 10 80703735 missense probably damaging 1.00
R1977:Izumo4 UTSW 10 80703121 missense probably damaging 1.00
R2237:Izumo4 UTSW 10 80702830 missense probably damaging 1.00
R5288:Izumo4 UTSW 10 80702805 nonsense probably null
R5543:Izumo4 UTSW 10 80702834 missense probably damaging 1.00
R5587:Izumo4 UTSW 10 80703220 missense probably damaging 1.00
R6199:Izumo4 UTSW 10 80702873 missense probably damaging 1.00
R6222:Izumo4 UTSW 10 80703051 missense probably damaging 1.00
R6349:Izumo4 UTSW 10 80702717 start codon destroyed probably null 0.02
V7580:Izumo4 UTSW 10 80703891 missense probably benign 0.02
V7581:Izumo4 UTSW 10 80703891 missense probably benign 0.02
V7582:Izumo4 UTSW 10 80703891 missense probably benign 0.02
V7583:Izumo4 UTSW 10 80703891 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATGGCTCATGCAGCAATCCCAC -3'
(R):5'- CATGAAGACCCTTCAGCCAGGATG -3'

Sequencing Primer
(F):5'- TTGGGGATACCCCACCAC -3'
(R):5'- TTCAGCCAGGATGGCTTGC -3'
Posted On2013-05-23