Incidental Mutation 'R0498:Lta4h'
ID40617
Institutional Source Beutler Lab
Gene Symbol Lta4h
Ensembl Gene ENSMUSG00000015889
Gene Nameleukotriene A4 hydrolase
SynonymsLTA4 hydrodase
MMRRC Submission 038694-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0498 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location93453411-93484875 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 93471971 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000016033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016033]
Predicted Effect probably benign
Transcript: ENSMUST00000016033
SMART Domains Protein: ENSMUSP00000016033
Gene: ENSMUSG00000015889

DomainStartEndE-ValueType
Pfam:Peptidase_M1 13 387 7.8e-80 PFAM
Leuk-A4-hydro_C 464 608 2.01e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216931
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: The protein encoded by this gene is an enzyme that contains both hydrolase and aminopeptidase activities. The hydrolase activity is used in the final step of the biosynthesis of leukotriene B4, a proinflammatory mediator. The aminopeptidase activity has been shown to degrade proline-glycine-proline (PGP), a neutrophil chemoattractant and biomarker for chronic obstructive pulmonary disease (COPD). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene have grossly normal phenotypes. Inflammatory reactions are reduced as are some other immunological responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,294 D220V probably benign Het
4933406M09Rik A G 1: 134,390,872 I461V possibly damaging Het
6720489N17Rik T C 13: 62,607,387 N39S probably damaging Het
Adgrf2 A G 17: 42,714,315 probably benign Het
Aldh18a1 A G 19: 40,574,272 V219A probably benign Het
Anapc10 A G 8: 79,774,981 D126G probably benign Het
Ap1m2 T C 9: 21,295,833 *426W probably null Het
Arhgap21 A G 2: 20,863,117 I865T probably damaging Het
Armc8 A G 9: 99,497,292 V527A probably damaging Het
Asic5 A T 3: 82,006,471 probably benign Het
Baz2b A C 2: 59,901,996 probably benign Het
Bpifa5 T C 2: 154,167,249 V237A probably damaging Het
Brip1 T A 11: 86,197,919 K52I possibly damaging Het
Cacna1g T C 11: 94,459,859 I387V probably damaging Het
Cbr4 A G 8: 61,495,073 I135V probably benign Het
Ccdc66 C T 14: 27,500,240 probably null Het
Cubn G A 2: 13,444,267 T999M probably damaging Het
Dpp8 C T 9: 65,045,795 probably benign Het
Dsg1b T C 18: 20,409,333 S966P possibly damaging Het
Erp27 T C 6: 136,919,864 probably benign Het
Fat4 A T 3: 38,980,637 I2813L probably benign Het
Fhod1 G A 8: 105,329,856 R1101C probably damaging Het
Hoxc9 T C 15: 102,983,927 S191P probably damaging Het
Izumo4 T C 10: 80,704,196 probably null Het
Kalrn C T 16: 34,054,891 D104N possibly damaging Het
Kank4 A T 4: 98,779,636 D191E probably benign Het
Kbtbd11 A G 8: 15,027,605 E68G probably benign Het
Kdr C T 5: 75,959,138 V654I probably benign Het
Klra1 A T 6: 130,372,819 probably null Het
Kmt2e T A 5: 23,478,972 Y373* probably null Het
Lepr A T 4: 101,745,692 M226L probably benign Het
Lrp1b T A 2: 41,458,405 I800F probably benign Het
Map3k7 T C 4: 31,974,814 probably benign Het
Map4k4 G A 1: 39,990,178 R371Q probably benign Het
Mme A G 3: 63,346,066 I444V probably damaging Het
Mms19 C T 19: 41,949,773 R582Q possibly damaging Het
Mtss1 A G 15: 58,945,437 S502P probably damaging Het
Myo3a G T 2: 22,577,429 A232S possibly damaging Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr727 A C 14: 50,127,293 T239P probably damaging Het
Olfr874 G A 9: 37,746,254 G40E probably damaging Het
Pcm1 G A 8: 41,293,769 S1335N probably benign Het
Pdzph1 A G 17: 58,973,830 F486L probably benign Het
Piezo2 T C 18: 63,102,174 K552R possibly damaging Het
Plekhs1 T A 19: 56,481,104 probably null Het
Pprc1 C T 19: 46,071,568 Q1514* probably null Het
Ralgapa1 T C 12: 55,689,791 T1831A possibly damaging Het
Rnpep G T 1: 135,265,352 D455E probably damaging Het
Rpgrip1 T A 14: 52,131,314 probably benign Het
Saxo1 A T 4: 86,478,896 M135K possibly damaging Het
Serpina12 T C 12: 104,035,789 T223A probably damaging Het
Serpinb3a A G 1: 107,047,150 F218L probably damaging Het
Serpinb9f T G 13: 33,326,007 probably benign Het
Spata33 A G 8: 123,221,923 D98G probably benign Het
Stard13 T A 5: 151,052,477 Y742F probably damaging Het
Tcrg-C3 T A 13: 19,261,092 M70K probably damaging Het
Tecta A G 9: 42,377,614 Y552H probably damaging Het
Tie1 A T 4: 118,479,161 probably benign Het
Tmem161a A G 8: 70,180,973 T254A probably benign Het
Tmem30a G T 9: 79,774,094 Y264* probably null Het
Tmem87a A T 2: 120,394,465 I105K probably benign Het
Tnrc6b A T 15: 80,858,719 D51V probably damaging Het
Trpc4 T C 3: 54,291,211 F519L probably damaging Het
Ttn T C 2: 76,709,581 T26027A probably damaging Het
Vmn1r198 A C 13: 22,354,974 H121P probably damaging Het
Vps33a A G 5: 123,570,961 F64L probably benign Het
Wdr63 G T 3: 146,081,364 D305E possibly damaging Het
Zfp994 A T 17: 22,200,901 C356S probably damaging Het
Other mutations in Lta4h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01946:Lta4h APN 10 93471370 splice site probably benign
IGL02309:Lta4h APN 10 93474490 missense probably damaging 1.00
IGL02351:Lta4h APN 10 93478467 missense probably benign 0.28
IGL02358:Lta4h APN 10 93478467 missense probably benign 0.28
IGL02589:Lta4h APN 10 93474931 missense probably benign 0.01
IGL02649:Lta4h APN 10 93472969 missense probably benign 0.00
IGL03164:Lta4h APN 10 93470797 splice site probably benign
R1451:Lta4h UTSW 10 93480728 missense probably damaging 0.99
R1690:Lta4h UTSW 10 93484692 missense probably benign
R1837:Lta4h UTSW 10 93469175 missense probably damaging 1.00
R4202:Lta4h UTSW 10 93470807 missense probably damaging 1.00
R4684:Lta4h UTSW 10 93468816 missense probably benign
R5528:Lta4h UTSW 10 93471874 missense probably damaging 1.00
R5637:Lta4h UTSW 10 93468869 intron probably null
R5873:Lta4h UTSW 10 93469190 critical splice donor site probably null
R6965:Lta4h UTSW 10 93471897 nonsense probably null
R7282:Lta4h UTSW 10 93453511 start codon destroyed probably null 0.98
R7779:Lta4h UTSW 10 93474949 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCAATAGCAAGATTGCCGCTTCC -3'
(R):5'- TGTTTCTTGGCTCCCAGTTTAGAACAG -3'

Sequencing Primer
(F):5'- TGTAGAGGCCATGCTATCTATAAGG -3'
(R):5'- CTCCCAGTTTAGAACAGGGCTATG -3'
Posted On2013-05-23