Incidental Mutation 'R0498:Rpgrip1'
ID40628
Institutional Source Beutler Lab
Gene Symbol Rpgrip1
Ensembl Gene ENSMUSG00000057132
Gene Nameretinitis pigmentosa GTPase regulator interacting protein 1
SynonymsA930002K18Rik, 4930505G06Rik, 4930401L23Rik, nmf247
MMRRC Submission 038694-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R0498 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location52110704-52163546 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 52131314 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000111600] [ENSMUST00000111603] [ENSMUST00000180646] [ENSMUST00000181401]
Predicted Effect probably benign
Transcript: ENSMUST00000111600
SMART Domains Protein: ENSMUSP00000107227
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 542 N/A INTRINSIC
C2 602 707 1.08e-2 SMART
coiled coil region 746 795 N/A INTRINSIC
Blast:C2 958 1086 1e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111603
SMART Domains Protein: ENSMUSP00000107230
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 543 N/A INTRINSIC
Pfam:C2-C2_1 582 721 1.9e-49 PFAM
C2 764 869 7.3e-5 SMART
coiled coil region 910 999 N/A INTRINSIC
Blast:C2 1162 1290 2e-37 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000180646
AA Change: N279K
SMART Domains Protein: ENSMUSP00000137751
Gene: ENSMUSG00000057132
AA Change: N279K

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181401
SMART Domains Protein: ENSMUSP00000138027
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 547 N/A INTRINSIC
Pfam:DUF3250 605 710 2.8e-46 PFAM
C2 753 858 1.08e-2 SMART
coiled coil region 899 988 N/A INTRINSIC
Blast:C2 1151 1279 1e-37 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181673
Predicted Effect probably benign
Transcript: ENSMUST00000181709
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181823
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a photoreceptor protein that interacts with retinitis pigmentosa GTPase regulator protein and is a key component of cone and rod photoreceptor cells. Mutations in this gene lead to autosomal recessive congenital blindness. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene results in photoreceptor cell dysmorphology. By 3 months of age mutant animals show near complete loss of photoreceptor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,294 D220V probably benign Het
4933406M09Rik A G 1: 134,390,872 I461V possibly damaging Het
6720489N17Rik T C 13: 62,607,387 N39S probably damaging Het
Adgrf2 A G 17: 42,714,315 probably benign Het
Aldh18a1 A G 19: 40,574,272 V219A probably benign Het
Anapc10 A G 8: 79,774,981 D126G probably benign Het
Ap1m2 T C 9: 21,295,833 *426W probably null Het
Arhgap21 A G 2: 20,863,117 I865T probably damaging Het
Armc8 A G 9: 99,497,292 V527A probably damaging Het
Asic5 A T 3: 82,006,471 probably benign Het
Baz2b A C 2: 59,901,996 probably benign Het
Bpifa5 T C 2: 154,167,249 V237A probably damaging Het
Brip1 T A 11: 86,197,919 K52I possibly damaging Het
Cacna1g T C 11: 94,459,859 I387V probably damaging Het
Cbr4 A G 8: 61,495,073 I135V probably benign Het
Ccdc66 C T 14: 27,500,240 probably null Het
Cubn G A 2: 13,444,267 T999M probably damaging Het
Dpp8 C T 9: 65,045,795 probably benign Het
Dsg1b T C 18: 20,409,333 S966P possibly damaging Het
Erp27 T C 6: 136,919,864 probably benign Het
Fat4 A T 3: 38,980,637 I2813L probably benign Het
Fhod1 G A 8: 105,329,856 R1101C probably damaging Het
Hoxc9 T C 15: 102,983,927 S191P probably damaging Het
Izumo4 T C 10: 80,704,196 probably null Het
Kalrn C T 16: 34,054,891 D104N possibly damaging Het
Kank4 A T 4: 98,779,636 D191E probably benign Het
Kbtbd11 A G 8: 15,027,605 E68G probably benign Het
Kdr C T 5: 75,959,138 V654I probably benign Het
Klra1 A T 6: 130,372,819 probably null Het
Kmt2e T A 5: 23,478,972 Y373* probably null Het
Lepr A T 4: 101,745,692 M226L probably benign Het
Lrp1b T A 2: 41,458,405 I800F probably benign Het
Lta4h T C 10: 93,471,971 probably benign Het
Map3k7 T C 4: 31,974,814 probably benign Het
Map4k4 G A 1: 39,990,178 R371Q probably benign Het
Mme A G 3: 63,346,066 I444V probably damaging Het
Mms19 C T 19: 41,949,773 R582Q possibly damaging Het
Mtss1 A G 15: 58,945,437 S502P probably damaging Het
Myo3a G T 2: 22,577,429 A232S possibly damaging Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr727 A C 14: 50,127,293 T239P probably damaging Het
Olfr874 G A 9: 37,746,254 G40E probably damaging Het
Pcm1 G A 8: 41,293,769 S1335N probably benign Het
Pdzph1 A G 17: 58,973,830 F486L probably benign Het
Piezo2 T C 18: 63,102,174 K552R possibly damaging Het
Plekhs1 T A 19: 56,481,104 probably null Het
Pprc1 C T 19: 46,071,568 Q1514* probably null Het
Ralgapa1 T C 12: 55,689,791 T1831A possibly damaging Het
Rnpep G T 1: 135,265,352 D455E probably damaging Het
Saxo1 A T 4: 86,478,896 M135K possibly damaging Het
Serpina12 T C 12: 104,035,789 T223A probably damaging Het
Serpinb3a A G 1: 107,047,150 F218L probably damaging Het
Serpinb9f T G 13: 33,326,007 probably benign Het
Spata33 A G 8: 123,221,923 D98G probably benign Het
Stard13 T A 5: 151,052,477 Y742F probably damaging Het
Tcrg-C3 T A 13: 19,261,092 M70K probably damaging Het
Tecta A G 9: 42,377,614 Y552H probably damaging Het
Tie1 A T 4: 118,479,161 probably benign Het
Tmem161a A G 8: 70,180,973 T254A probably benign Het
Tmem30a G T 9: 79,774,094 Y264* probably null Het
Tmem87a A T 2: 120,394,465 I105K probably benign Het
Tnrc6b A T 15: 80,858,719 D51V probably damaging Het
Trpc4 T C 3: 54,291,211 F519L probably damaging Het
Ttn T C 2: 76,709,581 T26027A probably damaging Het
Vmn1r198 A C 13: 22,354,974 H121P probably damaging Het
Vps33a A G 5: 123,570,961 F64L probably benign Het
Wdr63 G T 3: 146,081,364 D305E possibly damaging Het
Zfp994 A T 17: 22,200,901 C356S probably damaging Het
Other mutations in Rpgrip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Rpgrip1 APN 14 52150438 unclassified probably null
IGL01016:Rpgrip1 APN 14 52145836 missense probably damaging 1.00
IGL01019:Rpgrip1 APN 14 52131176 missense possibly damaging 0.70
IGL01382:Rpgrip1 APN 14 52145477 missense possibly damaging 0.93
IGL01433:Rpgrip1 APN 14 52126377 missense probably damaging 1.00
IGL01528:Rpgrip1 APN 14 52112177 nonsense probably null
IGL01548:Rpgrip1 APN 14 52126271 splice site probably benign
IGL01652:Rpgrip1 APN 14 52145492 unclassified probably benign
IGL02040:Rpgrip1 APN 14 52121019 missense possibly damaging 0.86
IGL02113:Rpgrip1 APN 14 52133844 missense possibly damaging 0.85
IGL02121:Rpgrip1 APN 14 52147374 missense possibly damaging 0.89
IGL02185:Rpgrip1 APN 14 52112228 missense possibly damaging 0.72
IGL02234:Rpgrip1 APN 14 52131309 splice site probably benign
IGL02322:Rpgrip1 APN 14 52150042 missense possibly damaging 0.89
IGL02379:Rpgrip1 APN 14 52138888 missense possibly damaging 0.53
IGL02524:Rpgrip1 APN 14 52121054 missense probably benign 0.01
IGL02836:Rpgrip1 APN 14 52145257 unclassified probably null
IGL03264:Rpgrip1 APN 14 52140652 missense possibly damaging 0.53
IGL03410:Rpgrip1 APN 14 52158366 unclassified probably benign
FR4976:Rpgrip1 UTSW 14 52149394 utr 3 prime probably benign
FR4976:Rpgrip1 UTSW 14 52149544 utr 3 prime probably benign
R0045:Rpgrip1 UTSW 14 52141144 missense possibly damaging 0.53
R0045:Rpgrip1 UTSW 14 52141144 missense possibly damaging 0.53
R0089:Rpgrip1 UTSW 14 52149384 utr 3 prime probably benign
R0602:Rpgrip1 UTSW 14 52133856 missense possibly damaging 0.72
R0776:Rpgrip1 UTSW 14 52141169 missense possibly damaging 0.85
R1139:Rpgrip1 UTSW 14 52147221 missense probably benign 0.33
R1528:Rpgrip1 UTSW 14 52112224 missense probably benign 0.01
R1715:Rpgrip1 UTSW 14 52140691 missense possibly damaging 0.53
R1934:Rpgrip1 UTSW 14 52114644 missense possibly damaging 0.53
R2087:Rpgrip1 UTSW 14 52136622 intron probably null
R2114:Rpgrip1 UTSW 14 52149567 missense probably benign 0.27
R3406:Rpgrip1 UTSW 14 52145209 missense possibly damaging 0.92
R3835:Rpgrip1 UTSW 14 52147253 missense probably damaging 1.00
R4084:Rpgrip1 UTSW 14 52149351 missense possibly damaging 0.72
R4124:Rpgrip1 UTSW 14 52152324 splice site probably null
R4381:Rpgrip1 UTSW 14 52150449 missense possibly damaging 0.54
R4407:Rpgrip1 UTSW 14 52147399 missense probably damaging 1.00
R4520:Rpgrip1 UTSW 14 52152289 missense probably benign 0.08
R4904:Rpgrip1 UTSW 14 52121087 missense possibly damaging 0.86
R4904:Rpgrip1 UTSW 14 52160129 missense probably damaging 0.97
R5284:Rpgrip1 UTSW 14 52149276 missense probably damaging 1.00
R5342:Rpgrip1 UTSW 14 52145209 missense possibly damaging 0.92
R5377:Rpgrip1 UTSW 14 52160195 missense possibly damaging 0.96
R5499:Rpgrip1 UTSW 14 52140585 missense probably benign 0.00
R5729:Rpgrip1 UTSW 14 52160160 missense probably benign 0.28
R5834:Rpgrip1 UTSW 14 52158382 missense probably damaging 0.99
R6157:Rpgrip1 UTSW 14 52112174 missense probably benign 0.00
R6455:Rpgrip1 UTSW 14 52141189 missense probably damaging 0.97
R6796:Rpgrip1 UTSW 14 52150012 missense probably damaging 1.00
R7065:Rpgrip1 UTSW 14 52141193 missense possibly damaging 0.96
R7173:Rpgrip1 UTSW 14 52112176 missense possibly damaging 0.59
R7302:Rpgrip1 UTSW 14 52149555 missense unknown
R7315:Rpgrip1 UTSW 14 52121001 missense not run
R7320:Rpgrip1 UTSW 14 52131216 missense possibly damaging 0.53
R7344:Rpgrip1 UTSW 14 52140659 missense probably damaging 0.98
R7459:Rpgrip1 UTSW 14 52140559 missense probably benign 0.18
R7797:Rpgrip1 UTSW 14 52133820 missense possibly damaging 0.53
RF005:Rpgrip1 UTSW 14 52149391 utr 3 prime probably benign
RF028:Rpgrip1 UTSW 14 52149398 nonsense probably null
RF034:Rpgrip1 UTSW 14 52149526 utr 3 prime probably benign
RF035:Rpgrip1 UTSW 14 52149393 utr 3 prime probably benign
RF036:Rpgrip1 UTSW 14 52149541 frame shift probably null
RF040:Rpgrip1 UTSW 14 52149537 frame shift probably null
RF043:Rpgrip1 UTSW 14 52149395 utr 3 prime probably benign
X0024:Rpgrip1 UTSW 14 52141208 missense possibly damaging 0.85
X0026:Rpgrip1 UTSW 14 52147221 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AGAATACCGGAGTTGCTGCTGTG -3'
(R):5'- GAGTCAGGGTTTTACCAAGATGGACTG -3'

Sequencing Primer
(F):5'- TGGAGACCACACCTCCTGAG -3'
(R):5'- CTTAGGTGTGCACGGTAAGT -3'
Posted On2013-05-23