Incidental Mutation 'R0498:Mtss1'
ID40629
Institutional Source Beutler Lab
Gene Symbol Mtss1
Ensembl Gene ENSMUSG00000022353
Gene Namemetastasis suppressor 1
SynonymsD130001D01Rik, 2310003N14Rik, MIM
MMRRC Submission 038694-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.669) question?
Stock #R0498 (G1)
Quality Score139
Status Validated
Chromosome15
Chromosomal Location58941234-59082005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58945437 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 502 (S502P)
Ref Sequence ENSEMBL: ENSMUSP00000079239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080371]
Predicted Effect probably damaging
Transcript: ENSMUST00000080371
AA Change: S502P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079239
Gene: ENSMUSG00000022353
AA Change: S502P

DomainStartEndE-ValueType
Pfam:IMD 16 241 2.1e-107 PFAM
low complexity region 257 309 N/A INTRINSIC
low complexity region 443 459 N/A INTRINSIC
low complexity region 612 628 N/A INTRINSIC
WH2 731 748 1.36e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226976
Predicted Effect probably benign
Transcript: ENSMUST00000227045
Predicted Effect probably benign
Transcript: ENSMUST00000227196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227290
Predicted Effect probably benign
Transcript: ENSMUST00000228067
Meta Mutation Damage Score 0.2842 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (68/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit polycystic kidney in 50% of mice by 5 months of age. Mouse embryonic fibroblasts from mice homozygous for a different gene trap allele exhibit altered cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,294 D220V probably benign Het
4933406M09Rik A G 1: 134,390,872 I461V possibly damaging Het
6720489N17Rik T C 13: 62,607,387 N39S probably damaging Het
Adgrf2 A G 17: 42,714,315 probably benign Het
Aldh18a1 A G 19: 40,574,272 V219A probably benign Het
Anapc10 A G 8: 79,774,981 D126G probably benign Het
Ap1m2 T C 9: 21,295,833 *426W probably null Het
Arhgap21 A G 2: 20,863,117 I865T probably damaging Het
Armc8 A G 9: 99,497,292 V527A probably damaging Het
Asic5 A T 3: 82,006,471 probably benign Het
Baz2b A C 2: 59,901,996 probably benign Het
Bpifa5 T C 2: 154,167,249 V237A probably damaging Het
Brip1 T A 11: 86,197,919 K52I possibly damaging Het
Cacna1g T C 11: 94,459,859 I387V probably damaging Het
Cbr4 A G 8: 61,495,073 I135V probably benign Het
Ccdc66 C T 14: 27,500,240 probably null Het
Cubn G A 2: 13,444,267 T999M probably damaging Het
Dpp8 C T 9: 65,045,795 probably benign Het
Dsg1b T C 18: 20,409,333 S966P possibly damaging Het
Erp27 T C 6: 136,919,864 probably benign Het
Fat4 A T 3: 38,980,637 I2813L probably benign Het
Fhod1 G A 8: 105,329,856 R1101C probably damaging Het
Hoxc9 T C 15: 102,983,927 S191P probably damaging Het
Izumo4 T C 10: 80,704,196 probably null Het
Kalrn C T 16: 34,054,891 D104N possibly damaging Het
Kank4 A T 4: 98,779,636 D191E probably benign Het
Kbtbd11 A G 8: 15,027,605 E68G probably benign Het
Kdr C T 5: 75,959,138 V654I probably benign Het
Klra1 A T 6: 130,372,819 probably null Het
Kmt2e T A 5: 23,478,972 Y373* probably null Het
Lepr A T 4: 101,745,692 M226L probably benign Het
Lrp1b T A 2: 41,458,405 I800F probably benign Het
Lta4h T C 10: 93,471,971 probably benign Het
Map3k7 T C 4: 31,974,814 probably benign Het
Map4k4 G A 1: 39,990,178 R371Q probably benign Het
Mme A G 3: 63,346,066 I444V probably damaging Het
Mms19 C T 19: 41,949,773 R582Q possibly damaging Het
Myo3a G T 2: 22,577,429 A232S possibly damaging Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr727 A C 14: 50,127,293 T239P probably damaging Het
Olfr874 G A 9: 37,746,254 G40E probably damaging Het
Pcm1 G A 8: 41,293,769 S1335N probably benign Het
Pdzph1 A G 17: 58,973,830 F486L probably benign Het
Piezo2 T C 18: 63,102,174 K552R possibly damaging Het
Plekhs1 T A 19: 56,481,104 probably null Het
Pprc1 C T 19: 46,071,568 Q1514* probably null Het
Ralgapa1 T C 12: 55,689,791 T1831A possibly damaging Het
Rnpep G T 1: 135,265,352 D455E probably damaging Het
Rpgrip1 T A 14: 52,131,314 probably benign Het
Saxo1 A T 4: 86,478,896 M135K possibly damaging Het
Serpina12 T C 12: 104,035,789 T223A probably damaging Het
Serpinb3a A G 1: 107,047,150 F218L probably damaging Het
Serpinb9f T G 13: 33,326,007 probably benign Het
Spata33 A G 8: 123,221,923 D98G probably benign Het
Stard13 T A 5: 151,052,477 Y742F probably damaging Het
Tcrg-C3 T A 13: 19,261,092 M70K probably damaging Het
Tecta A G 9: 42,377,614 Y552H probably damaging Het
Tie1 A T 4: 118,479,161 probably benign Het
Tmem161a A G 8: 70,180,973 T254A probably benign Het
Tmem30a G T 9: 79,774,094 Y264* probably null Het
Tmem87a A T 2: 120,394,465 I105K probably benign Het
Tnrc6b A T 15: 80,858,719 D51V probably damaging Het
Trpc4 T C 3: 54,291,211 F519L probably damaging Het
Ttn T C 2: 76,709,581 T26027A probably damaging Het
Vmn1r198 A C 13: 22,354,974 H121P probably damaging Het
Vps33a A G 5: 123,570,961 F64L probably benign Het
Wdr63 G T 3: 146,081,364 D305E possibly damaging Het
Zfp994 A T 17: 22,200,901 C356S probably damaging Het
Other mutations in Mtss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Mtss1 APN 15 58951468 critical splice donor site probably null
IGL00693:Mtss1 APN 15 58944124 missense probably damaging 1.00
IGL00817:Mtss1 APN 15 58943632 unclassified probably null
IGL00923:Mtss1 APN 15 58943499 missense possibly damaging 0.80
IGL01704:Mtss1 APN 15 59055083 missense possibly damaging 0.91
IGL02257:Mtss1 APN 15 58956545 missense probably damaging 1.00
IGL02632:Mtss1 APN 15 58944015 missense probably damaging 0.99
IGL02829:Mtss1 APN 15 59058428 splice site probably benign
IGL02838:Mtss1 APN 15 59081515 missense probably benign 0.06
IGL02968:Mtss1 APN 15 58956515 missense possibly damaging 0.77
IGL03012:Mtss1 APN 15 59058400 missense probably damaging 0.97
IGL03022:Mtss1 APN 15 58953590 missense probably damaging 1.00
R0193:Mtss1 UTSW 15 58944017 missense probably damaging 0.99
R0510:Mtss1 UTSW 15 58956538 missense probably benign 0.07
R0655:Mtss1 UTSW 15 59081502 missense probably damaging 0.99
R1183:Mtss1 UTSW 15 58971048 missense probably damaging 0.97
R1428:Mtss1 UTSW 15 58947390 missense probably benign 0.04
R1503:Mtss1 UTSW 15 58951672 missense probably damaging 1.00
R1597:Mtss1 UTSW 15 58943711 missense probably damaging 1.00
R1795:Mtss1 UTSW 15 59058400 missense possibly damaging 0.92
R3689:Mtss1 UTSW 15 58953536 missense probably damaging 1.00
R4724:Mtss1 UTSW 15 59081518 missense probably damaging 0.98
R4811:Mtss1 UTSW 15 58944073 missense probably damaging 1.00
R4968:Mtss1 UTSW 15 58943918 missense probably damaging 1.00
R5082:Mtss1 UTSW 15 58971019 missense probably damaging 1.00
R5783:Mtss1 UTSW 15 58943524 missense probably benign 0.05
R6253:Mtss1 UTSW 15 58943719 missense probably benign 0.02
R6767:Mtss1 UTSW 15 58953581 missense probably benign 0.00
R6890:Mtss1 UTSW 15 58951659 missense probably damaging 1.00
R7001:Mtss1 UTSW 15 58948334 intron probably benign
R7502:Mtss1 UTSW 15 58948361 missense probably damaging 0.96
R7722:Mtss1 UTSW 15 59055086 missense probably damaging 1.00
R7867:Mtss1 UTSW 15 58971009 missense possibly damaging 0.82
R7888:Mtss1 UTSW 15 58972524 missense probably damaging 1.00
R7950:Mtss1 UTSW 15 58971009 missense possibly damaging 0.82
R7971:Mtss1 UTSW 15 58972524 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCCATGTGTAGCCAGGGGTTAG -3'
(R):5'- CCCAGCTCCACAATGTGTAAGACAG -3'

Sequencing Primer
(F):5'- AGCCAGGGGTTAGGCTATG -3'
(R):5'- GGGACATAGAACTCTAGTTCCTGC -3'
Posted On2013-05-23