Mutagenetix > Incidental Mutations

Incidental Mutation 'R0498:Tnrc6b'

40630

Institutional Source

Beutler Lab

Gene Symbol

Tnrc6b

Ensembl Gene

ENSMUSG00000047888

Gene Name

trinucleotide repeat containing 6b

Synonyms

MMRRC Submission

038694-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.197) question?

Stock #

R0498 (G1)

Quality Score

194

Status

Validated

Chromosome

Chromosomal Location

80711313-80941085 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 80858719 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 51 (D51V)

Ref Sequence

ENSEMBL: ENSMUSP00000064336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067689]

Predicted Effect

probably damaging
Transcript: ENSMUST00000067689
AA Change: D51V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: D51V

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
coiled coil region	33	72	N/A	INTRINSIC
low complexity region	88	106	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC
low complexity region	207	220	N/A	INTRINSIC
low complexity region	242	260	N/A	INTRINSIC
low complexity region	331	346	N/A	INTRINSIC
low complexity region	363	380	N/A	INTRINSIC
low complexity region	416	425	N/A	INTRINSIC
low complexity region	475	487	N/A	INTRINSIC
internal_repeat_1	488	667	6.43e-5	PROSPERO
low complexity region	858	888	N/A	INTRINSIC
Pfam:Ago_hook	955	1095	1.2e-28	PFAM
coiled coil region	1258	1307	N/A	INTRINSIC
Pfam:TNRC6-PABC_bdg	1339	1623	2.8e-112	PFAM
Pfam:RRM_5	1641	1695	2e-7	PFAM
low complexity region	1705	1721	N/A	INTRINSIC
low complexity region	1748	1769	N/A	INTRINSIC
low complexity region	1792	1809	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226857

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228071

Meta Mutation Damage Score

0.0828

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.4%

Validation Efficiency

100% (68/68)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,294	D220V	probably benign	Het
4933406M09Rik	A	G	1: 134,390,872	I461V	possibly damaging	Het
6720489N17Rik	T	C	13: 62,607,387	N39S	probably damaging	Het
Adgrf2	A	G	17: 42,714,315		probably benign	Het
Aldh18a1	A	G	19: 40,574,272	V219A	probably benign	Het
Anapc10	A	G	8: 79,774,981	D126G	probably benign	Het
Ap1m2	T	C	9: 21,295,833	*426W	probably null	Het
Arhgap21	A	G	2: 20,863,117	I865T	probably damaging	Het
Armc8	A	G	9: 99,497,292	V527A	probably damaging	Het
Asic5	A	T	3: 82,006,471		probably benign	Het
Baz2b	A	C	2: 59,901,996		probably benign	Het
Bpifa5	T	C	2: 154,167,249	V237A	probably damaging	Het
Brip1	T	A	11: 86,197,919	K52I	possibly damaging	Het
Cacna1g	T	C	11: 94,459,859	I387V	probably damaging	Het
Cbr4	A	G	8: 61,495,073	I135V	probably benign	Het
Ccdc66	C	T	14: 27,500,240		probably null	Het
Cubn	G	A	2: 13,444,267	T999M	probably damaging	Het
Dpp8	C	T	9: 65,045,795		probably benign	Het
Dsg1b	T	C	18: 20,409,333	S966P	possibly damaging	Het
Erp27	T	C	6: 136,919,864		probably benign	Het
Fat4	A	T	3: 38,980,637	I2813L	probably benign	Het
Fhod1	G	A	8: 105,329,856	R1101C	probably damaging	Het
Hoxc9	T	C	15: 102,983,927	S191P	probably damaging	Het
Izumo4	T	C	10: 80,704,196		probably null	Het
Kalrn	C	T	16: 34,054,891	D104N	possibly damaging	Het
Kank4	A	T	4: 98,779,636	D191E	probably benign	Het
Kbtbd11	A	G	8: 15,027,605	E68G	probably benign	Het
Kdr	C	T	5: 75,959,138	V654I	probably benign	Het
Klra1	A	T	6: 130,372,819		probably null	Het
Kmt2e	T	A	5: 23,478,972	Y373*	probably null	Het
Lepr	A	T	4: 101,745,692	M226L	probably benign	Het
Lrp1b	T	A	2: 41,458,405	I800F	probably benign	Het
Lta4h	T	C	10: 93,471,971		probably benign	Het
Map3k7	T	C	4: 31,974,814		probably benign	Het
Map4k4	G	A	1: 39,990,178	R371Q	probably benign	Het
Mme	A	G	3: 63,346,066	I444V	probably damaging	Het
Mms19	C	T	19: 41,949,773	R582Q	possibly damaging	Het
Mtss1	A	G	15: 58,945,437	S502P	probably damaging	Het
Myo3a	G	T	2: 22,577,429	A232S	possibly damaging	Het
Nwd2	G	T	5: 63,806,343	W1090L	probably damaging	Het
Olfr727	A	C	14: 50,127,293	T239P	probably damaging	Het
Olfr874	G	A	9: 37,746,254	G40E	probably damaging	Het
Pcm1	G	A	8: 41,293,769	S1335N	probably benign	Het
Pdzph1	A	G	17: 58,973,830	F486L	probably benign	Het
Piezo2	T	C	18: 63,102,174	K552R	possibly damaging	Het
Plekhs1	T	A	19: 56,481,104		probably null	Het
Pprc1	C	T	19: 46,071,568	Q1514*	probably null	Het
Ralgapa1	T	C	12: 55,689,791	T1831A	possibly damaging	Het
Rnpep	G	T	1: 135,265,352	D455E	probably damaging	Het
Rpgrip1	T	A	14: 52,131,314		probably benign	Het
Saxo1	A	T	4: 86,478,896	M135K	possibly damaging	Het
Serpina12	T	C	12: 104,035,789	T223A	probably damaging	Het
Serpinb3a	A	G	1: 107,047,150	F218L	probably damaging	Het
Serpinb9f	T	G	13: 33,326,007		probably benign	Het
Spata33	A	G	8: 123,221,923	D98G	probably benign	Het
Stard13	T	A	5: 151,052,477	Y742F	probably damaging	Het
Tcrg-C3	T	A	13: 19,261,092	M70K	probably damaging	Het
Tecta	A	G	9: 42,377,614	Y552H	probably damaging	Het
Tie1	A	T	4: 118,479,161		probably benign	Het
Tmem161a	A	G	8: 70,180,973	T254A	probably benign	Het
Tmem30a	G	T	9: 79,774,094	Y264*	probably null	Het
Tmem87a	A	T	2: 120,394,465	I105K	probably benign	Het
Trpc4	T	C	3: 54,291,211	F519L	probably damaging	Het
Ttn	T	C	2: 76,709,581	T26027A	probably damaging	Het
Vmn1r198	A	C	13: 22,354,974	H121P	probably damaging	Het
Vps33a	A	G	5: 123,570,961	F64L	probably benign	Het
Wdr63	G	T	3: 146,081,364	D305E	possibly damaging	Het
Zfp994	A	T	17: 22,200,901	C356S	probably damaging	Het

Other mutations in Tnrc6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01312:Tnrc6b	APN	15	80923578	missense	probably damaging	1.00
IGL01402:Tnrc6b	APN	15	80880544	missense	possibly damaging	0.71
IGL01505:Tnrc6b	APN	15	80879963	missense	probably benign	0.00
IGL01516:Tnrc6b	APN	15	80902622	missense	possibly damaging	0.93
IGL01584:Tnrc6b	APN	15	80879682	missense	probably benign	0.01
IGL01681:Tnrc6b	APN	15	80879311	splice site	probably null
IGL01909:Tnrc6b	APN	15	80901983	missense	possibly damaging	0.88
IGL01943:Tnrc6b	APN	15	80927695	nonsense	probably null
IGL02253:Tnrc6b	APN	15	80876541	missense	probably damaging	0.99
IGL02260:Tnrc6b	APN	15	80880171	missense	probably damaging	0.99
IGL02437:Tnrc6b	APN	15	80880457	missense	probably damaging	1.00
IGL02541:Tnrc6b	APN	15	80879831	missense	probably benign	0.00
IGL02542:Tnrc6b	APN	15	80902352	missense	possibly damaging	0.83
grosser	UTSW	15	80929285	missense	probably damaging	1.00
heiliger	UTSW	15	80927741	critical splice donor site	probably null
PIT1430001:Tnrc6b	UTSW	15	80929186	missense	probably damaging	0.99
R0092:Tnrc6b	UTSW	15	80918528	missense	probably damaging	1.00
R0165:Tnrc6b	UTSW	15	80858670	splice site	probably null
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0257:Tnrc6b	UTSW	15	80894355	missense	possibly damaging	0.80
R0418:Tnrc6b	UTSW	15	80913323	missense	probably benign	0.27
R0432:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0487:Tnrc6b	UTSW	15	80880675	missense	probably benign	0.01
R0528:Tnrc6b	UTSW	15	80879403	missense	probably benign	0.00
R0533:Tnrc6b	UTSW	15	80876653	missense	probably benign	0.00
R0571:Tnrc6b	UTSW	15	80913338	missense	probably damaging	1.00
R0650:Tnrc6b	UTSW	15	80784758	missense	probably benign	0.33
R0659:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0884:Tnrc6b	UTSW	15	80902555	small deletion	probably benign
R1131:Tnrc6b	UTSW	15	80894453	missense	possibly damaging	0.45
R1188:Tnrc6b	UTSW	15	80879229	missense	probably benign
R1479:Tnrc6b	UTSW	15	80887032	splice site	probably null
R1564:Tnrc6b	UTSW	15	80880168	missense	possibly damaging	0.95
R1645:Tnrc6b	UTSW	15	80882958	missense	probably damaging	0.99
R1924:Tnrc6b	UTSW	15	80884206	critical splice acceptor site	probably null
R1926:Tnrc6b	UTSW	15	80881162	missense	probably damaging	1.00
R1928:Tnrc6b	UTSW	15	80880723	missense	probably damaging	1.00
R1965:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R1966:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R2072:Tnrc6b	UTSW	15	80882965	missense	possibly damaging	0.89
R3084:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3552:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3736:Tnrc6b	UTSW	15	80889163	splice site	probably benign
R3791:Tnrc6b	UTSW	15	80923640	missense	probably damaging	1.00
R4170:Tnrc6b	UTSW	15	80916787	missense	probably benign	0.24
R4276:Tnrc6b	UTSW	15	80901971	missense	probably benign	0.42
R4519:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R5380:Tnrc6b	UTSW	15	80879565	missense	possibly damaging	0.56
R5470:Tnrc6b	UTSW	15	80916711	missense	possibly damaging	0.89
R5590:Tnrc6b	UTSW	15	80876502	missense	probably damaging	0.98
R5982:Tnrc6b	UTSW	15	80880816	missense	probably benign
R6269:Tnrc6b	UTSW	15	80880743	missense	probably benign	0.42
R6331:Tnrc6b	UTSW	15	80879614	missense	probably benign	0.00
R6484:Tnrc6b	UTSW	15	80879324	missense	possibly damaging	0.92
R6622:Tnrc6b	UTSW	15	80879184	missense	probably damaging	0.99
R6695:Tnrc6b	UTSW	15	80879773	missense	probably damaging	1.00
R6728:Tnrc6b	UTSW	15	80918526	missense	probably damaging	1.00
R6776:Tnrc6b	UTSW	15	80924119	missense	possibly damaging	0.87
R7159:Tnrc6b	UTSW	15	80887022	missense	possibly damaging	0.92
R7210:Tnrc6b	UTSW	15	80929285	missense	probably damaging	1.00
R7287:Tnrc6b	UTSW	15	80879541	missense	possibly damaging	0.83
R7402:Tnrc6b	UTSW	15	80884300	missense	probably damaging	1.00
R7479:Tnrc6b	UTSW	15	80889126	missense	probably benign	0.13
R7533:Tnrc6b	UTSW	15	80927741	critical splice donor site	probably null
R7571:Tnrc6b	UTSW	15	80929393	missense	probably benign
R7594:Tnrc6b	UTSW	15	80880307	missense	possibly damaging	0.66
R7831:Tnrc6b	UTSW	15	80880379	missense	possibly damaging	0.49
R8208:Tnrc6b	UTSW	15	80858700	missense	possibly damaging	0.53
R8276:Tnrc6b	UTSW	15	80880717	missense	probably benign	0.00
R8295:Tnrc6b	UTSW	15	80913364	missense	probably damaging	1.00
R8351:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8423:Tnrc6b	UTSW	15	80929418	missense	unknown
R8451:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8725:Tnrc6b	UTSW	15	80876452	missense	probably damaging	1.00
R8872:Tnrc6b	UTSW	15	80918089	missense	probably benign	0.23
X0020:Tnrc6b	UTSW	15	80882997	missense	probably benign	0.16
X0025:Tnrc6b	UTSW	15	80881167	missense	probably benign	0.03
Z1088:Tnrc6b	UTSW	15	80927690	nonsense	probably null
Z1177:Tnrc6b	UTSW	15	80858699	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- GGCATCTTTGAAACCAAGCCTATGTG -3'
(R):5'- ACTAGAACCTGTCTGAGGGCAGTTAC -3'

Sequencing Primer
(F):5'- CAAACTCTGATGGGGGAATACC -3'
(R):5'- GACATGAGTTGAGACTTTCTTCATAC -3'

Posted On

2013-05-23