Mutagenetix > Incidental Mutation

Incidental Mutation 'R0025:Wdfy3'

40766

Institutional Source

Beutler Lab

Gene Symbol

Wdfy3

Ensembl Gene

ENSMUSG00000043940

Gene Name

WD repeat and FYVE domain containing 3

Synonyms

D5Ertd66e, Bwf1, Bchs, 2610509D04Rik, Ggtb3

MMRRC Submission

038320-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.948) question?

Stock #

R0025 (G1)

Quality Score

118

Status

Validated

Chromosome

Chromosomal Location

101832956-102069921 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 101845046 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 3341 (D3341G)

Ref Sequence

ENSEMBL: ENSMUSP00000134244 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053177] [ENSMUST00000174598] [ENSMUST00000212024]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000053177
AA Change: D3323G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000052607
Gene: ENSMUSG00000043940
AA Change: D3323G

Domain	Start	End	E-Value	Type
low complexity region	463	481	N/A	INTRINSIC
low complexity region	1408	1417	N/A	INTRINSIC
low complexity region	1629	1644	N/A	INTRINSIC
Pfam:PH_BEACH	2517	2638	3.1e-17	PFAM
Beach	2677	2958	2.54e-217	SMART
WD40	3054	3088	1.28e1	SMART
WD40	3098	3137	7.73e-6	SMART
WD40	3140	3178	8.29e-1	SMART
WD40	3183	3227	3.09e-1	SMART
low complexity region	3253	3274	N/A	INTRINSIC
low complexity region	3307	3318	N/A	INTRINSIC
WD40	3381	3420	1.33e1	SMART
FYVE	3428	3497	3.18e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173528

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173955

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173965

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174312

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174528

Predicted Effect

probably damaging
Transcript: ENSMUST00000174598
AA Change: D3341G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000134244
Gene: ENSMUSG00000043940
AA Change: D3341G

Domain	Start	End	E-Value	Type
low complexity region	463	481	N/A	INTRINSIC
Pfam:DUF4704	1392	1597	6.6e-11	PFAM
low complexity region	1629	1644	N/A	INTRINSIC
Pfam:PH_BEACH	2588	2656	1.8e-14	PFAM
Beach	2695	2976	2.54e-217	SMART
WD40	3072	3106	1.28e1	SMART
WD40	3116	3155	7.73e-6	SMART
WD40	3158	3196	8.29e-1	SMART
WD40	3201	3245	3.09e-1	SMART
low complexity region	3271	3292	N/A	INTRINSIC
low complexity region	3325	3336	N/A	INTRINSIC
WD40	3399	3438	1.33e1	SMART
FYVE	3446	3515	3.18e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174864

Predicted Effect

possibly damaging
Transcript: ENSMUST00000212024
AA Change: D3327G

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)

Meta Mutation Damage Score

0.1500

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.7%
20x: 90.3%

Validation Efficiency

98% (115/117)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for hypomorphic mutations of this gene exhibit perinatal lethality, altered neural progenitor divisions and neuronal migration, a regionally enlarged cerebral cortex, and focal cortical dysplasias. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016K19Rik	AGAGGAGGAGGAGGAGG	AGAGGAGGAGGAGG	11: 76,000,115		probably benign	Het
Acsm1	A	T	7: 119,658,315	T435S	probably damaging	Het
Agtpbp1	G	A	13: 59,500,200	T602I	probably benign	Het
Ahnak2	T	A	12: 112,785,534	D231V	probably damaging	Het
Ampd3	G	A	7: 110,793,669	D215N	probably benign	Het
Ankrd17	T	C	5: 90,250,405	D1762G	probably damaging	Het
Asb8	C	T	15: 98,142,671	V37I	possibly damaging	Het
Bicra	T	C	7: 15,987,511	T694A	possibly damaging	Het
Btnl6	A	T	17: 34,514,299	M234K	probably benign	Het
Ccnb1	A	T	13: 100,779,781	V336D	probably damaging	Het
Cdca8	A	T	4: 124,921,254	L190Q	possibly damaging	Het
Cep290	A	T	10: 100,537,831	L1324F	probably damaging	Het
Ces1f	T	C	8: 93,271,885	E161G	probably benign	Het
Ces2g	A	G	8: 104,965,996		probably benign	Het
Cfap74	C	T	4: 155,426,115	R386C	probably benign	Het
Clec3b	A	G	9: 123,157,025	T163A	probably benign	Het
Cntnap4	T	G	8: 112,803,164	L668R	probably damaging	Het
Col27a1	A	G	4: 63,275,977	D857G	probably damaging	Het
Csf1	A	G	3: 107,748,644	V245A	probably benign	Het
Ctss	A	G	3: 95,550,137	Y302C	probably damaging	Het
Cyb5d1	A	G	11: 69,394,966		probably null	Het
Cyp1a2	A	G	9: 57,682,061	S157P	probably damaging	Het
Cyp2b9	A	T	7: 26,200,813	T349S	probably benign	Het
Dennd6b	T	C	15: 89,186,183	I428V	probably benign	Het
Denr	A	G	5: 123,927,235		probably benign	Het
Dnah9	G	A	11: 65,969,955		probably benign	Het
Dock3	G	T	9: 106,913,268	Q1419K	possibly damaging	Het
Dph3b-ps	A	T	13: 106,546,867		noncoding transcript	Het
Emc7	G	T	2: 112,459,485	D87Y	probably damaging	Het
Enah	T	C	1: 181,913,373	E462G	possibly damaging	Het
Eno1b	T	C	18: 48,047,739	I328T	probably benign	Het
Enpp6	A	G	8: 47,066,000	K268E	probably damaging	Het
Eps15l1	T	G	8: 72,381,497		probably benign	Het
Fam151a	T	C	4: 106,748,174	Y578H	probably benign	Het
Fmn2	T	C	1: 174,791,314	V1512A	probably damaging	Het
Focad	C	A	4: 88,408,959	N168K	probably benign	Het
Fyco1	A	G	9: 123,829,009	C701R	probably damaging	Het
Gabbr1	G	T	17: 37,067,210		probably benign	Het
Golga7b	A	T	19: 42,266,839	E76V	probably damaging	Het
Gucy2d	A	G	7: 98,467,752	D924G	probably benign	Het
H2-M9	A	G	17: 36,641,755	F133S	probably damaging	Het
Hc	A	G	2: 34,986,292	Y1581H	probably damaging	Het
Herc3	C	T	6: 58,874,308	P514L	probably damaging	Het
Hormad1	T	C	3: 95,585,125		probably benign	Het
Iigp1	T	A	18: 60,390,787	S326T	possibly damaging	Het
Itga2	G	A	13: 114,870,496	S432L	possibly damaging	Het
Kcnk7	T	G	19: 5,707,014	*344G	probably null	Het
Kif13a	A	G	13: 46,786,511		probably null	Het
Kif1a	A	C	1: 93,042,358	I1027S	probably damaging	Het
Kif2c	G	T	4: 117,165,517	H416Q	probably damaging	Het
Map3k1	A	G	13: 111,756,129	V864A	probably benign	Het
Mark2	T	C	19: 7,285,922	D160G	probably damaging	Het
Mbd4	A	G	6: 115,844,568		probably null	Het
Micu1	A	G	10: 59,788,877		probably null	Het
Mink1	T	C	11: 70,613,042	W1263R	probably damaging	Het
Mov10	A	C	3: 104,804,603	L224R	probably damaging	Het
Ndel1	T	C	11: 68,836,173	E226G	probably damaging	Het
Neb	A	T	2: 52,222,774	V4336E	probably damaging	Het
Nln	T	A	13: 104,036,891	K602N	probably damaging	Het
Nlrp14	A	T	7: 107,181,258		probably benign	Het
Nmd3	A	T	3: 69,748,321	D445V	probably damaging	Het
Nop14	T	C	5: 34,643,953	I625V	probably benign	Het
Notch1	T	C	2: 26,470,931	Q1134R	probably damaging	Het
Nr4a2	T	C	2: 57,108,615	I392M	probably benign	Het
Olfr1310	T	A	2: 112,009,020	L55F	probably damaging	Het
Olfr702	A	G	7: 106,823,756	F257L	possibly damaging	Het
Olfr983	A	G	9: 40,092,253	S234P	probably damaging	Het
Osbp	T	C	19: 11,983,958	Y454H	probably damaging	Het
Pak4	G	A	7: 28,564,283	R343C	probably damaging	Het
Pak7	T	C	2: 136,100,784	K479E	possibly damaging	Het
Pard3	C	A	8: 127,161,308	D73E	probably damaging	Het
Pcdh10	T	C	3: 45,380,499	V416A	possibly damaging	Het
Plek	A	C	11: 16,985,594	W261G	probably damaging	Het
Pmp22	A	T	11: 63,158,250		probably null	Het
Prph2	A	C	17: 46,919,771	K197Q	probably benign	Het
Prss45	T	A	9: 110,840,894	L257Q	probably damaging	Het
Psmb6	C	A	11: 70,526,345	H73Q	probably benign	Het
Rin2	T	C	2: 145,878,832		probably benign	Het
Rps6kb1	A	T	11: 86,511,587		probably null	Het
Scn10a	C	A	9: 119,670,484	D248Y	probably damaging	Het
Scn4a	C	T	11: 106,324,560	V1197I	probably benign	Het
Siglecf	A	T	7: 43,351,925	I106F	probably benign	Het
Sik1	A	G	17: 31,847,275		probably benign	Het
Slc22a21	T	G	11: 53,979,688	N57T	probably damaging	Het
Slc36a2	A	G	11: 55,162,795	L339P	probably damaging	Het
Slc4a9	G	T	18: 36,531,666		probably benign	Het
Smg1	G	A	7: 118,212,443	T104I	possibly damaging	Het
Stc2	A	T	11: 31,365,559		probably null	Het
Stx18	T	A	5: 38,092,564	Y74N	probably damaging	Het
Stxbp5	A	T	10: 9,762,748	H1102Q	probably damaging	Het
Tnfaip8l2	G	A	3: 95,140,028	L175F	probably damaging	Het
Tom1l2	T	C	11: 60,230,134	K450E	probably damaging	Het
Tpo	T	C	12: 30,100,390	Q497R	probably benign	Het
Tprgl	G	T	4: 154,160,345		probably benign	Het
Triml2	A	G	8: 43,185,432	M146V	probably benign	Het
Tsc2	A	G	17: 24,631,004		probably benign	Het
Vit	G	A	17: 78,599,835	G229R	probably benign	Het
Vmn2r19	C	T	6: 123,331,547	L528F	probably benign	Het
Vwf	T	A	6: 125,682,812	I2658N	probably benign	Het
Wdr36	T	A	18: 32,859,307	D632E	probably damaging	Het
Wdr47	G	T	3: 108,637,991	A733S	probably damaging	Het
Zcchc6	A	T	13: 59,805,328	D99E	probably benign	Het
Zfp458	T	A	13: 67,257,898	H156L	probably damaging	Het
Zfp654	A	G	16: 64,784,818	V466A	probably benign	Het
Zfp804b	T	C	5: 6,771,665	E466G	probably damaging	Het
Zfp941	T	C	7: 140,813,272	D58G	probably benign	Het

Other mutations in Wdfy3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Wdfy3	APN	5	101915338	critical splice donor site	probably null
IGL00567:Wdfy3	APN	5	101912030	splice site	probably benign
IGL01288:Wdfy3	APN	5	101901991	splice site	probably null
IGL01323:Wdfy3	APN	5	101895064	missense	probably damaging	1.00
IGL01352:Wdfy3	APN	5	101944120	missense	probably damaging	1.00
IGL01553:Wdfy3	APN	5	101900031	missense	probably benign
IGL01560:Wdfy3	APN	5	101957486	nonsense	probably null
IGL01566:Wdfy3	APN	5	101896588	splice site	probably benign
IGL01616:Wdfy3	APN	5	101913260	missense	probably damaging	0.97
IGL01630:Wdfy3	APN	5	101907488	missense	probably benign
IGL01791:Wdfy3	APN	5	101937412	missense	probably damaging	1.00
IGL01820:Wdfy3	APN	5	101924081	missense	probably benign	0.11
IGL01953:Wdfy3	APN	5	101895028	nonsense	probably null
IGL02121:Wdfy3	APN	5	101898510	missense	possibly damaging	0.85
IGL02167:Wdfy3	APN	5	101961157	missense	probably damaging	0.98
IGL02321:Wdfy3	APN	5	101922609	missense	probably damaging	0.99
IGL02327:Wdfy3	APN	5	101888192	missense	probably damaging	1.00
IGL02651:Wdfy3	APN	5	101896475	missense	probably benign	0.37
IGL02801:Wdfy3	APN	5	101907587	missense	probably damaging	1.00
IGL02839:Wdfy3	APN	5	101968920	missense	probably damaging	1.00
IGL02870:Wdfy3	APN	5	101855471	missense	probably damaging	1.00
IGL02997:Wdfy3	APN	5	101894912	missense	probably null	1.00
IGL03064:Wdfy3	APN	5	101935997	missense	probably damaging	0.99
IGL03090:Wdfy3	APN	5	101866276	missense	probably damaging	1.00
IGL03211:Wdfy3	APN	5	101844912	splice site	probably benign
IGL03237:Wdfy3	APN	5	101844599	missense	probably damaging	1.00
IGL03264:Wdfy3	APN	5	101900150	missense	probably damaging	1.00
Esurient	UTSW	5	101944103	missense	probably damaging	1.00
IGL02988:Wdfy3	UTSW	5	101929981	missense	probably damaging	0.99
PIT4382001:Wdfy3	UTSW	5	101882961	frame shift	probably null
R0010:Wdfy3	UTSW	5	101848349	missense	probably damaging	1.00
R0010:Wdfy3	UTSW	5	101848349	missense	probably damaging	1.00
R0031:Wdfy3	UTSW	5	101889295	missense	probably damaging	0.97
R0047:Wdfy3	UTSW	5	101944033	missense	probably damaging	1.00
R0047:Wdfy3	UTSW	5	101944033	missense	probably damaging	1.00
R0053:Wdfy3	UTSW	5	101844614	missense	probably damaging	0.97
R0078:Wdfy3	UTSW	5	101888105	missense	possibly damaging	0.57
R0147:Wdfy3	UTSW	5	101917411	missense	probably benign	0.05
R0148:Wdfy3	UTSW	5	101917411	missense	probably benign	0.05
R0279:Wdfy3	UTSW	5	101868092	missense	probably damaging	1.00
R0380:Wdfy3	UTSW	5	101948966	missense	probably damaging	0.99
R0472:Wdfy3	UTSW	5	101957443	missense	probably benign	0.13
R0513:Wdfy3	UTSW	5	101890789	missense	probably damaging	0.96
R0594:Wdfy3	UTSW	5	101906185	missense	possibly damaging	0.94
R0601:Wdfy3	UTSW	5	101836172	missense	probably benign
R0787:Wdfy3	UTSW	5	101957388	missense	probably damaging	1.00
R0825:Wdfy3	UTSW	5	101870051	missense	probably damaging	1.00
R1122:Wdfy3	UTSW	5	101882966	missense	possibly damaging	0.94
R1167:Wdfy3	UTSW	5	101875931	missense	probably benign
R1350:Wdfy3	UTSW	5	101898552	missense	probably damaging	1.00
R1422:Wdfy3	UTSW	5	101884214	splice site	probably benign
R1446:Wdfy3	UTSW	5	101851310	missense	possibly damaging	0.68
R1452:Wdfy3	UTSW	5	101937738	missense	possibly damaging	0.91
R1457:Wdfy3	UTSW	5	101917579	missense	possibly damaging	0.57
R1543:Wdfy3	UTSW	5	101844081	missense	probably benign
R1633:Wdfy3	UTSW	5	101981548	missense	probably damaging	1.00
R1643:Wdfy3	UTSW	5	101875915	missense	possibly damaging	0.62
R1656:Wdfy3	UTSW	5	101941447	missense	probably damaging	1.00
R1720:Wdfy3	UTSW	5	101926525	frame shift	probably null
R1743:Wdfy3	UTSW	5	101844065	missense	probably benign	0.12
R1745:Wdfy3	UTSW	5	101948929	missense	probably damaging	0.96
R1850:Wdfy3	UTSW	5	101894999	missense	probably damaging	1.00
R1852:Wdfy3	UTSW	5	101915376	missense	probably benign	0.00
R1854:Wdfy3	UTSW	5	101888186	missense	probably benign	0.05
R1880:Wdfy3	UTSW	5	101917435	missense	probably benign	0.05
R1930:Wdfy3	UTSW	5	101941492	missense	probably damaging	1.00
R1931:Wdfy3	UTSW	5	101941492	missense	probably damaging	1.00
R1956:Wdfy3	UTSW	5	101919409	missense	probably benign	0.30
R1965:Wdfy3	UTSW	5	101951312	missense	probably damaging	1.00
R1997:Wdfy3	UTSW	5	101968946	missense	probably damaging	1.00
R2015:Wdfy3	UTSW	5	101860486	missense	probably null	1.00
R2087:Wdfy3	UTSW	5	101895060	missense	probably damaging	1.00
R2156:Wdfy3	UTSW	5	101898425	critical splice donor site	probably null
R2192:Wdfy3	UTSW	5	101907542	missense	possibly damaging	0.55
R2313:Wdfy3	UTSW	5	101889284	missense	probably damaging	1.00
R2332:Wdfy3	UTSW	5	101888323	splice site	probably benign
R2406:Wdfy3	UTSW	5	101888259	missense	probably damaging	1.00
R2679:Wdfy3	UTSW	5	101870036	missense	probably damaging	1.00
R2857:Wdfy3	UTSW	5	101875930	missense	probably benign	0.04
R2937:Wdfy3	UTSW	5	101944122	missense	probably benign	0.07
R3765:Wdfy3	UTSW	5	101861400	missense	probably damaging	1.00
R3795:Wdfy3	UTSW	5	101937600	missense	probably damaging	1.00
R3937:Wdfy3	UTSW	5	101944239	nonsense	probably null
R3947:Wdfy3	UTSW	5	101870036	missense	probably damaging	1.00
R4024:Wdfy3	UTSW	5	101924095	splice site	probably benign
R4065:Wdfy3	UTSW	5	101922447	missense	probably benign	0.08
R4066:Wdfy3	UTSW	5	101922447	missense	probably benign	0.08
R4110:Wdfy3	UTSW	5	101900058	critical splice donor site	probably null
R4235:Wdfy3	UTSW	5	101922634	critical splice acceptor site	probably null
R4420:Wdfy3	UTSW	5	101910984	missense	probably damaging	0.97
R4620:Wdfy3	UTSW	5	101906145	missense	probably damaging	0.99
R4624:Wdfy3	UTSW	5	101884083	missense	possibly damaging	0.52
R4626:Wdfy3	UTSW	5	101943934	missense	probably damaging	1.00
R4727:Wdfy3	UTSW	5	101930028	missense	probably damaging	0.99
R4794:Wdfy3	UTSW	5	101943943	missense	probably damaging	1.00
R4869:Wdfy3	UTSW	5	101894921	missense	probably damaging	0.98
R4971:Wdfy3	UTSW	5	101948972	nonsense	probably null
R4973:Wdfy3	UTSW	5	101943119	missense	probably benign	0.00
R4976:Wdfy3	UTSW	5	101943119	missense	probably benign	0.00
R4984:Wdfy3	UTSW	5	101943119	missense	probably benign	0.00
R4986:Wdfy3	UTSW	5	101943119	missense	probably benign	0.00
R5068:Wdfy3	UTSW	5	101894937	missense	probably benign	0.15
R5105:Wdfy3	UTSW	5	101855549	missense	probably damaging	1.00
R5120:Wdfy3	UTSW	5	101868106	missense	possibly damaging	0.85
R5134:Wdfy3	UTSW	5	101944103	missense	probably damaging	1.00
R5139:Wdfy3	UTSW	5	101849267	critical splice donor site	probably null
R5235:Wdfy3	UTSW	5	101847106	missense	probably null	0.03
R5303:Wdfy3	UTSW	5	101952983	missense	probably damaging	1.00
R5368:Wdfy3	UTSW	5	101872858	missense	probably damaging	1.00
R5426:Wdfy3	UTSW	5	101919446	missense	probably damaging	0.97
R5442:Wdfy3	UTSW	5	101896559	missense	probably benign	0.04
R5487:Wdfy3	UTSW	5	101836274	missense	probably damaging	1.00
R5509:Wdfy3	UTSW	5	101861448	missense	possibly damaging	0.69
R5877:Wdfy3	UTSW	5	101869989	missense	probably damaging	1.00
R5988:Wdfy3	UTSW	5	101884138	missense	probably benign	0.00
R6017:Wdfy3	UTSW	5	101851359	missense	probably benign	0.01
R6019:Wdfy3	UTSW	5	101849423	missense	probably damaging	1.00
R6199:Wdfy3	UTSW	5	101872965	missense	possibly damaging	0.93
R6228:Wdfy3	UTSW	5	101898429	missense	possibly damaging	0.67
R6258:Wdfy3	UTSW	5	101872965	missense	possibly damaging	0.93
R6259:Wdfy3	UTSW	5	101872965	missense	possibly damaging	0.93
R6298:Wdfy3	UTSW	5	101968946	missense	probably damaging	1.00
R6479:Wdfy3	UTSW	5	101913179	missense	probably damaging	1.00
R6550:Wdfy3	UTSW	5	101953166	missense	probably benign	0.19
R6776:Wdfy3	UTSW	5	101884045	missense	possibly damaging	0.57
R6793:Wdfy3	UTSW	5	101917431	nonsense	probably null
R6809:Wdfy3	UTSW	5	101923947	missense	possibly damaging	0.63
R6836:Wdfy3	UTSW	5	101952999	missense	probably damaging	1.00
R6897:Wdfy3	UTSW	5	101844066	missense	probably benign	0.10
R7014:Wdfy3	UTSW	5	101894909	critical splice donor site	probably null
R7034:Wdfy3	UTSW	5	101907518	missense	probably damaging	1.00
R7035:Wdfy3	UTSW	5	101855549	missense	probably damaging	1.00
R7135:Wdfy3	UTSW	5	101915437	missense	probably damaging	1.00
R7182:Wdfy3	UTSW	5	101943892	missense	possibly damaging	0.51
R7217:Wdfy3	UTSW	5	101901919	missense	probably damaging	1.00
R7236:Wdfy3	UTSW	5	101836208	missense	probably damaging	0.99
R7264:Wdfy3	UTSW	5	101855523	missense	probably benign	0.02
R7418:Wdfy3	UTSW	5	101957500	missense	probably benign	0.08
R7533:Wdfy3	UTSW	5	101882488	missense	probably benign	0.27
R7543:Wdfy3	UTSW	5	101936059	missense	probably benign	0.00
R7625:Wdfy3	UTSW	5	101855386	splice site	probably null
R7788:Wdfy3	UTSW	5	101848357	missense	probably damaging	0.99
R7810:Wdfy3	UTSW	5	101895074	missense	probably benign	0.01
R7810:Wdfy3	UTSW	5	101951399	nonsense	probably null
R8204:Wdfy3	UTSW	5	101852585	missense	probably benign	0.00
R8268:Wdfy3	UTSW	5	101941610	missense	probably damaging	1.00
R8286:Wdfy3	UTSW	5	101937421	missense	probably benign
R8507:Wdfy3	UTSW	5	101872901	missense	probably benign	0.05
R8514:Wdfy3	UTSW	5	101851353	missense	possibly damaging	0.92
R8536:Wdfy3	UTSW	5	101885198	missense	probably benign
R8710:Wdfy3	UTSW	5	101882483	missense	probably damaging	1.00
R8735:Wdfy3	UTSW	5	101930085	missense	probably benign	0.00
R8749:Wdfy3	UTSW	5	101882580	missense	probably damaging	1.00
R8931:Wdfy3	UTSW	5	101917555	missense	probably benign	0.11
R8943:Wdfy3	UTSW	5	101845365	intron	probably benign
R8968:Wdfy3	UTSW	5	101864117	missense	probably benign	0.05
R8979:Wdfy3	UTSW	5	101948898	missense	probably damaging	1.00
R8998:Wdfy3	UTSW	5	101845192	missense	probably benign	0.05
R9045:Wdfy3	UTSW	5	101847174	missense	probably damaging	1.00
R9068:Wdfy3	UTSW	5	101852585	missense	probably benign	0.34
R9105:Wdfy3	UTSW	5	101882646	missense	probably benign	0.05
R9122:Wdfy3	UTSW	5	101943965	missense	probably damaging	1.00
R9209:Wdfy3	UTSW	5	101930964	missense	probably benign	0.01
R9249:Wdfy3	UTSW	5	101848493	missense	possibly damaging	0.82
R9348:Wdfy3	UTSW	5	101941492	missense	probably damaging	1.00
R9481:Wdfy3	UTSW	5	101852612	missense	probably benign	0.19
R9490:Wdfy3	UTSW	5	101930850	missense	probably benign	0.29
R9524:Wdfy3	UTSW	5	101907467	missense	probably benign	0.03
R9545:Wdfy3	UTSW	5	101953091	missense
R9548:Wdfy3	UTSW	5	101885193	missense	probably damaging	0.99
R9636:Wdfy3	UTSW	5	101900033	missense	probably benign
R9750:Wdfy3	UTSW	5	101930094	missense	probably benign	0.00
R9766:Wdfy3	UTSW	5	101895000	missense	possibly damaging	0.90
R9771:Wdfy3	UTSW	5	101852329	missense	probably damaging	1.00
Z1177:Wdfy3	UTSW	5	101900241	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- TGCCTAGCCTGATCTATGGGAGAAC -3'
(R):5'- CCCAAGATGACGACAGCAGTGATTC -3'

Sequencing Primer
(F):5'- TCTTTGGCTCAGGCACAG -3'
(R):5'- CGACAGCAGTGATTCTGAAAC -3'

Posted On

2013-05-23