Incidental Mutation 'R0025:Smg1'
ID40781
Institutional Source Beutler Lab
Gene Symbol Smg1
Ensembl Gene ENSMUSG00000030655
Gene NameSMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Synonyms2610207I05Rik, 5430435M13Rik, C130002K18Rik
MMRRC Submission 038320-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0025 (G1)
Quality Score203
Status Validated
Chromosome7
Chromosomal Location118131308-118243670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118212443 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 104 (T104I)
Ref Sequence ENSEMBL: ENSMUSP00000137172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032891] [ENSMUST00000179047]
Predicted Effect unknown
Transcript: ENSMUST00000032891
AA Change: T128I
SMART Domains Protein: ENSMUSP00000032891
Gene: ENSMUSG00000030655
AA Change: T128I

DomainStartEndE-ValueType
low complexity region 42 55 N/A INTRINSIC
SCOP:d1gw5a_ 147 621 7e-7 SMART
Pfam:SMG1 629 1240 9.8e-249 PFAM
low complexity region 1540 1551 N/A INTRINSIC
SCOP:d1gw5a_ 1680 1942 8e-3 SMART
low complexity region 2125 2141 N/A INTRINSIC
PI3Kc 2149 2493 7.93e-50 SMART
low complexity region 2759 2770 N/A INTRINSIC
low complexity region 3425 3442 N/A INTRINSIC
FATC 3626 3658 8.66e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000179047
AA Change: T104I

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137172
Gene: ENSMUSG00000030655
AA Change: T104I

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
SCOP:d1gw5a_ 123 282 7e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179331
SMART Domains Protein: ENSMUSP00000137592
Gene: ENSMUSG00000030655

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
SCOP:d1gw5a_ 71 545 1e-6 SMART
low complexity region 602 612 N/A INTRINSIC
low complexity region 631 646 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
low complexity region 898 915 N/A INTRINSIC
low complexity region 1135 1147 N/A INTRINSIC
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 2049 2065 N/A INTRINSIC
PI3Kc 2073 2417 7.93e-50 SMART
low complexity region 2683 2694 N/A INTRINSIC
low complexity region 3349 3366 N/A INTRINSIC
FATC 3550 3582 8.66e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208209
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency 98% (115/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in nonsense-mediated mRNA decay (NMD) as part of the mRNA surveillance complex. The protein has kinase activity and is thought to function in NMD by phosphorylating the regulator of nonsense transcripts 1 protein. Alternatively spliced transcript variants have been described, but their full-length nature has yet to be determined. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early embryonic lethality. Mice heteroygous for a gene trap allele exhibit abnormal tooth development, chronic inflammation, increased body weight, increased incidence of tumor formation and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 11: 76,000,115 probably benign Het
Acsm1 A T 7: 119,658,315 T435S probably damaging Het
Agtpbp1 G A 13: 59,500,200 T602I probably benign Het
Ahnak2 T A 12: 112,785,534 D231V probably damaging Het
Ampd3 G A 7: 110,793,669 D215N probably benign Het
Ankrd17 T C 5: 90,250,405 D1762G probably damaging Het
Asb8 C T 15: 98,142,671 V37I possibly damaging Het
Bicra T C 7: 15,987,511 T694A possibly damaging Het
Btnl6 A T 17: 34,514,299 M234K probably benign Het
Ccnb1 A T 13: 100,779,781 V336D probably damaging Het
Cdca8 A T 4: 124,921,254 L190Q possibly damaging Het
Cep290 A T 10: 100,537,831 L1324F probably damaging Het
Ces1f T C 8: 93,271,885 E161G probably benign Het
Ces2g A G 8: 104,965,996 probably benign Het
Cfap74 C T 4: 155,426,115 R386C probably benign Het
Clec3b A G 9: 123,157,025 T163A probably benign Het
Cntnap4 T G 8: 112,803,164 L668R probably damaging Het
Col27a1 A G 4: 63,275,977 D857G probably damaging Het
Csf1 A G 3: 107,748,644 V245A probably benign Het
Ctss A G 3: 95,550,137 Y302C probably damaging Het
Cyb5d1 A G 11: 69,394,966 probably null Het
Cyp1a2 A G 9: 57,682,061 S157P probably damaging Het
Cyp2b9 A T 7: 26,200,813 T349S probably benign Het
Dennd6b T C 15: 89,186,183 I428V probably benign Het
Denr A G 5: 123,927,235 probably benign Het
Dnah9 G A 11: 65,969,955 probably benign Het
Dock3 G T 9: 106,913,268 Q1419K possibly damaging Het
Dph3b-ps A T 13: 106,546,867 noncoding transcript Het
Emc7 G T 2: 112,459,485 D87Y probably damaging Het
Enah T C 1: 181,913,373 E462G possibly damaging Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Enpp6 A G 8: 47,066,000 K268E probably damaging Het
Eps15l1 T G 8: 72,381,497 probably benign Het
Fam151a T C 4: 106,748,174 Y578H probably benign Het
Fmn2 T C 1: 174,791,314 V1512A probably damaging Het
Focad C A 4: 88,408,959 N168K probably benign Het
Fyco1 A G 9: 123,829,009 C701R probably damaging Het
Gabbr1 G T 17: 37,067,210 probably benign Het
Golga7b A T 19: 42,266,839 E76V probably damaging Het
Gucy2d A G 7: 98,467,752 D924G probably benign Het
H2-M9 A G 17: 36,641,755 F133S probably damaging Het
Hc A G 2: 34,986,292 Y1581H probably damaging Het
Herc3 C T 6: 58,874,308 P514L probably damaging Het
Hormad1 T C 3: 95,585,125 probably benign Het
Iigp1 T A 18: 60,390,787 S326T possibly damaging Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Kcnk7 T G 19: 5,707,014 *344G probably null Het
Kif13a A G 13: 46,786,511 probably null Het
Kif1a A C 1: 93,042,358 I1027S probably damaging Het
Kif2c G T 4: 117,165,517 H416Q probably damaging Het
Map3k1 A G 13: 111,756,129 V864A probably benign Het
Mark2 T C 19: 7,285,922 D160G probably damaging Het
Mbd4 A G 6: 115,844,568 probably null Het
Micu1 A G 10: 59,788,877 probably null Het
Mink1 T C 11: 70,613,042 W1263R probably damaging Het
Mov10 A C 3: 104,804,603 L224R probably damaging Het
Ndel1 T C 11: 68,836,173 E226G probably damaging Het
Neb A T 2: 52,222,774 V4336E probably damaging Het
Nln T A 13: 104,036,891 K602N probably damaging Het
Nlrp14 A T 7: 107,181,258 probably benign Het
Nmd3 A T 3: 69,748,321 D445V probably damaging Het
Nop14 T C 5: 34,643,953 I625V probably benign Het
Notch1 T C 2: 26,470,931 Q1134R probably damaging Het
Nr4a2 T C 2: 57,108,615 I392M probably benign Het
Olfr1310 T A 2: 112,009,020 L55F probably damaging Het
Olfr702 A G 7: 106,823,756 F257L possibly damaging Het
Olfr983 A G 9: 40,092,253 S234P probably damaging Het
Osbp T C 19: 11,983,958 Y454H probably damaging Het
Pak4 G A 7: 28,564,283 R343C probably damaging Het
Pak7 T C 2: 136,100,784 K479E possibly damaging Het
Pard3 C A 8: 127,161,308 D73E probably damaging Het
Pcdh10 T C 3: 45,380,499 V416A possibly damaging Het
Plek A C 11: 16,985,594 W261G probably damaging Het
Pmp22 A T 11: 63,158,250 probably null Het
Prph2 A C 17: 46,919,771 K197Q probably benign Het
Prss45 T A 9: 110,840,894 L257Q probably damaging Het
Psmb6 C A 11: 70,526,345 H73Q probably benign Het
Rin2 T C 2: 145,878,832 probably benign Het
Rps6kb1 A T 11: 86,511,587 probably null Het
Scn10a C A 9: 119,670,484 D248Y probably damaging Het
Scn4a C T 11: 106,324,560 V1197I probably benign Het
Siglecf A T 7: 43,351,925 I106F probably benign Het
Sik1 A G 17: 31,847,275 probably benign Het
Slc22a21 T G 11: 53,979,688 N57T probably damaging Het
Slc36a2 A G 11: 55,162,795 L339P probably damaging Het
Slc4a9 G T 18: 36,531,666 probably benign Het
Stc2 A T 11: 31,365,559 probably null Het
Stx18 T A 5: 38,092,564 Y74N probably damaging Het
Stxbp5 A T 10: 9,762,748 H1102Q probably damaging Het
Tnfaip8l2 G A 3: 95,140,028 L175F probably damaging Het
Tom1l2 T C 11: 60,230,134 K450E probably damaging Het
Tpo T C 12: 30,100,390 Q497R probably benign Het
Tprgl G T 4: 154,160,345 probably benign Het
Triml2 A G 8: 43,185,432 M146V probably benign Het
Tsc2 A G 17: 24,631,004 probably benign Het
Vit G A 17: 78,599,835 G229R probably benign Het
Vmn2r19 C T 6: 123,331,547 L528F probably benign Het
Vwf T A 6: 125,682,812 I2658N probably benign Het
Wdfy3 T C 5: 101,845,046 D3341G probably damaging Het
Wdr36 T A 18: 32,859,307 D632E probably damaging Het
Wdr47 G T 3: 108,637,991 A733S probably damaging Het
Zcchc6 A T 13: 59,805,328 D99E probably benign Het
Zfp458 T A 13: 67,257,898 H156L probably damaging Het
Zfp654 A G 16: 64,784,818 V466A probably benign Het
Zfp804b T C 5: 6,771,665 E466G probably damaging Het
Zfp941 T C 7: 140,813,272 D58G probably benign Het
Other mutations in Smg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Smg1 APN 7 118198271 utr 3 prime probably benign
IGL00481:Smg1 APN 7 118210794 missense possibly damaging 0.67
IGL00503:Smg1 APN 7 118185483 utr 3 prime probably benign
IGL00927:Smg1 APN 7 118140632 missense probably damaging 1.00
IGL01333:Smg1 APN 7 118163378 splice site probably benign
IGL01344:Smg1 APN 7 118190836 utr 3 prime probably benign
IGL01397:Smg1 APN 7 118163221 utr 3 prime probably benign
IGL01403:Smg1 APN 7 118158132 utr 3 prime probably benign
IGL01573:Smg1 APN 7 118167962 utr 3 prime probably benign
IGL01872:Smg1 APN 7 118148944 utr 3 prime probably benign
IGL02010:Smg1 APN 7 118186146 utr 3 prime probably benign
IGL02158:Smg1 APN 7 118212946 missense possibly damaging 0.77
IGL02268:Smg1 APN 7 118182541 missense probably benign 0.19
IGL02314:Smg1 APN 7 118154709 utr 3 prime probably benign
IGL02552:Smg1 APN 7 118195894 utr 3 prime probably benign
IGL02577:Smg1 APN 7 118203122 missense probably damaging 0.99
IGL02859:Smg1 APN 7 118148933 utr 3 prime probably benign
IGL02890:Smg1 APN 7 118185501 utr 3 prime probably benign
IGL02892:Smg1 APN 7 118167955 utr 3 prime probably benign
IGL03119:Smg1 APN 7 118195113 utr 3 prime probably benign
IGL03123:Smg1 APN 7 118157181 utr 3 prime probably benign
IGL03128:Smg1 APN 7 118203059 missense probably benign 0.03
IGL03184:Smg1 APN 7 118180380 missense possibly damaging 0.86
PIT4508001:Smg1 UTSW 7 118185541 missense unknown
R0010:Smg1 UTSW 7 118171859 utr 3 prime probably benign
R0010:Smg1 UTSW 7 118171859 utr 3 prime probably benign
R0025:Smg1 UTSW 7 118212443 missense possibly damaging 0.92
R0098:Smg1 UTSW 7 118145467 missense probably benign 0.02
R0139:Smg1 UTSW 7 118152675 critical splice donor site probably null
R0371:Smg1 UTSW 7 118168300 utr 3 prime probably benign
R0415:Smg1 UTSW 7 118182468 missense probably benign 0.34
R0416:Smg1 UTSW 7 118184461 splice site probably benign
R0423:Smg1 UTSW 7 118176880 missense possibly damaging 0.53
R0600:Smg1 UTSW 7 118160383 utr 3 prime probably benign
R0626:Smg1 UTSW 7 118182383 missense possibly damaging 0.82
R0627:Smg1 UTSW 7 118167861 utr 3 prime probably benign
R0727:Smg1 UTSW 7 118166422 utr 3 prime probably benign
R0729:Smg1 UTSW 7 118146289 utr 3 prime probably benign
R0841:Smg1 UTSW 7 118143301 missense possibly damaging 0.96
R1114:Smg1 UTSW 7 118159790 utr 3 prime probably benign
R1256:Smg1 UTSW 7 118203087 missense probably damaging 1.00
R1298:Smg1 UTSW 7 118168211 utr 3 prime probably benign
R1370:Smg1 UTSW 7 118159752 utr 3 prime probably benign
R1591:Smg1 UTSW 7 118156919 utr 3 prime probably benign
R1736:Smg1 UTSW 7 118165967 splice site probably null
R1755:Smg1 UTSW 7 118203064 nonsense probably null
R1765:Smg1 UTSW 7 118139715 missense probably benign 0.03
R1789:Smg1 UTSW 7 118145798 missense possibly damaging 0.73
R1845:Smg1 UTSW 7 118154622 utr 3 prime probably benign
R1908:Smg1 UTSW 7 118154199 utr 3 prime probably benign
R1909:Smg1 UTSW 7 118154199 utr 3 prime probably benign
R1942:Smg1 UTSW 7 118158103 utr 3 prime probably benign
R2064:Smg1 UTSW 7 118156867 utr 3 prime probably benign
R2072:Smg1 UTSW 7 118163166 utr 3 prime probably benign
R2154:Smg1 UTSW 7 118158076 utr 3 prime probably benign
R2895:Smg1 UTSW 7 118189143 utr 3 prime probably benign
R2915:Smg1 UTSW 7 118210879 splice site probably benign
R3416:Smg1 UTSW 7 118148853 utr 3 prime probably benign
R3417:Smg1 UTSW 7 118148853 utr 3 prime probably benign
R3873:Smg1 UTSW 7 118154662 utr 3 prime probably benign
R4082:Smg1 UTSW 7 118160246 utr 3 prime probably benign
R4230:Smg1 UTSW 7 118148733 critical splice donor site probably null
R4304:Smg1 UTSW 7 118139518 missense probably benign 0.03
R4549:Smg1 UTSW 7 118159683 utr 3 prime probably benign
R4571:Smg1 UTSW 7 118139465 missense possibly damaging 0.72
R4638:Smg1 UTSW 7 118195926 utr 3 prime probably benign
R4642:Smg1 UTSW 7 118154264 utr 3 prime probably benign
R4656:Smg1 UTSW 7 118212951 missense probably benign 0.00
R4754:Smg1 UTSW 7 118156731 utr 3 prime probably benign
R4798:Smg1 UTSW 7 118180474 missense probably benign 0.32
R4906:Smg1 UTSW 7 118152408 utr 3 prime probably benign
R4978:Smg1 UTSW 7 118154247 utr 3 prime probably benign
R4989:Smg1 UTSW 7 118158100 utr 3 prime probably benign
R4989:Smg1 UTSW 7 118208051 missense probably benign
R5026:Smg1 UTSW 7 118193545 utr 3 prime probably benign
R5124:Smg1 UTSW 7 118213012 missense probably benign 0.00
R5318:Smg1 UTSW 7 118160204 utr 3 prime probably benign
R5356:Smg1 UTSW 7 118195133 utr 3 prime probably benign
R5404:Smg1 UTSW 7 118206908 missense probably damaging 1.00
R5423:Smg1 UTSW 7 118146071 missense possibly damaging 0.70
R5441:Smg1 UTSW 7 118195081 utr 3 prime probably benign
R5490:Smg1 UTSW 7 118139436 missense possibly damaging 0.86
R5541:Smg1 UTSW 7 118157163 utr 3 prime probably benign
R5564:Smg1 UTSW 7 118189819 utr 3 prime probably benign
R5580:Smg1 UTSW 7 118148902 utr 3 prime probably benign
R5600:Smg1 UTSW 7 118167884 utr 3 prime probably benign
R5628:Smg1 UTSW 7 118154701 utr 3 prime probably benign
R5646:Smg1 UTSW 7 118212559 missense probably benign 0.42
R5656:Smg1 UTSW 7 118154664 utr 3 prime probably benign
R5660:Smg1 UTSW 7 118143347 missense probably benign 0.33
R5706:Smg1 UTSW 7 118145590 missense possibly damaging 0.86
R5786:Smg1 UTSW 7 118212897 missense probably benign 0.12
R5890:Smg1 UTSW 7 118190586 utr 3 prime probably benign
R5912:Smg1 UTSW 7 118154586 utr 3 prime probably benign
R5977:Smg1 UTSW 7 118141357 utr 3 prime probably benign
R5993:Smg1 UTSW 7 118140509 missense probably benign 0.33
R6161:Smg1 UTSW 7 118163330 utr 3 prime probably benign
R6187:Smg1 UTSW 7 118189163 utr 3 prime probably benign
R6264:Smg1 UTSW 7 118166087 utr 3 prime probably benign
R6331:Smg1 UTSW 7 118154277 utr 3 prime probably benign
R6561:Smg1 UTSW 7 118166077 utr 3 prime probably benign
R6571:Smg1 UTSW 7 118184514 utr 3 prime probably benign
R6736:Smg1 UTSW 7 118157166 utr 3 prime probably benign
R6752:Smg1 UTSW 7 118163316 utr 3 prime probably benign
R6777:Smg1 UTSW 7 118189117 utr 3 prime probably benign
R6788:Smg1 UTSW 7 118184571 utr 3 prime probably benign
R6883:Smg1 UTSW 7 118168180 utr 3 prime probably benign
R6991:Smg1 UTSW 7 118167868 utr 3 prime probably benign
R7056:Smg1 UTSW 7 118146400 splice site probably benign
R7058:Smg1 UTSW 7 118198279 utr 3 prime probably benign
R7100:Smg1 UTSW 7 118184520 missense unknown
R7133:Smg1 UTSW 7 118152908 missense unknown
R7221:Smg1 UTSW 7 118182797 missense possibly damaging 0.86
R7229:Smg1 UTSW 7 118176955 missense probably benign 0.03
R7293:Smg1 UTSW 7 118166099 missense unknown
R7361:Smg1 UTSW 7 118184977 missense unknown
R7438:Smg1 UTSW 7 118195893 missense unknown
R7686:Smg1 UTSW 7 118167858 missense unknown
Z1088:Smg1 UTSW 7 118154635 utr 3 prime probably benign
Z1088:Smg1 UTSW 7 118168661 nonsense probably null
Z1088:Smg1 UTSW 7 118178399 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CGCTTACCATATCCACTGCCTATTCAGA -3'
(R):5'- AGGTTCTTCCAGGCTACTGTCTCATTTA -3'

Sequencing Primer
(F):5'- ggaggcagaggtaggtgg -3'
(R):5'- CTACTCATCTTGCAATGAAGGG -3'
Posted On2013-05-23