Incidental Mutation 'R0049:Ngf'
ID40860
Institutional Source Beutler Lab
Gene Symbol Ngf
Ensembl Gene ENSMUSG00000027859
Gene Namenerve growth factor
SynonymsNgfb
MMRRC Submission 038343-MU
Accession Numbers

Ncbi RefSeq: NM_013609.2, NM_001112698.1; MGI:97321

Is this an essential gene? Possibly essential (E-score: 0.596) question?
Stock #R0049 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location102469919-102521013 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 102520345 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 137 (R137*)
Ref Sequence ENSEMBL: ENSMUSP00000142801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035952] [ENSMUST00000106925] [ENSMUST00000198644]
Predicted Effect probably null
Transcript: ENSMUST00000035952
AA Change: R75*
SMART Domains Protein: ENSMUSP00000040345
Gene: ENSMUSG00000027859
AA Change: R75*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
NGF 128 232 1.41e-78 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106925
AA Change: R141*
SMART Domains Protein: ENSMUSP00000102538
Gene: ENSMUSG00000027859
AA Change: R141*

DomainStartEndE-ValueType
NGF 194 298 1.41e-78 SMART
Predicted Effect probably null
Transcript: ENSMUST00000198644
AA Change: R137*
SMART Domains Protein: ENSMUSP00000142801
Gene: ENSMUSG00000027859
AA Change: R137*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
NGF 190 294 7.1e-81 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (114/115)
MGI Phenotype Strain: 1857535
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is incorporated into a larger complex. This protein has nerve growth stimulating activity and the complex is involved in the regulation of growth and the differentiation of sympathetic and certain sensory neurons. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy, type 5 (HSAN5), and dysregulation of this gene's expression is associated with allergic rhinitis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit elevated pain threshold, loss of neurons in both sensory and sympathetic ganglia, but diminished apoptosis in the retina and spinal cord. Heterozygotes exhibit a substantially reduced number of sympathetic neurons. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,638,308 H9L possibly damaging Het
Aars T A 8: 111,052,451 I739K possibly damaging Het
Abcb1b T A 5: 8,825,661 H611Q probably damaging Het
Acod1 T A 14: 103,055,207 I389K possibly damaging Het
Adgre1 T A 17: 57,402,841 L166* probably null Het
Akap1 C A 11: 88,839,624 probably null Het
Akna T A 4: 63,394,635 Q417L probably damaging Het
Anxa7 T C 14: 20,462,610 D285G probably damaging Het
Arhgap1 T C 2: 91,670,169 Y308H probably damaging Het
Arhgef10 A C 8: 14,954,446 R360S probably damaging Het
Arhgef11 T A 3: 87,729,193 probably null Het
Arid3a A G 10: 79,931,065 T58A possibly damaging Het
Atp6v0a4 G A 6: 38,082,081 R256C probably damaging Het
Camsap3 C A 8: 3,598,772 S163R probably benign Het
Ccdc110 A T 8: 45,942,626 E518V probably damaging Het
Ccdc180 G A 4: 45,930,119 probably null Het
Ccnt1 T C 15: 98,565,079 M71V probably benign Het
Celsr2 T A 3: 108,397,254 Y2263F probably benign Het
Cfap36 A T 11: 29,246,514 probably null Het
Cfap69 T C 5: 5,613,734 T498A probably benign Het
Chadl T C 15: 81,694,012 D6G probably benign Het
Clstn3 T A 6: 124,459,853 I132F possibly damaging Het
Cnot4 A G 6: 35,051,277 V468A probably benign Het
Crmp1 T G 5: 37,265,273 D141E possibly damaging Het
Crtc1 A G 8: 70,391,859 probably null Het
Cryz C A 3: 154,611,552 A136D probably damaging Het
Dph6 A G 2: 114,523,044 V221A probably benign Het
Dst A T 1: 34,275,781 N4267Y probably damaging Het
Duox2 T A 2: 122,296,686 D170V possibly damaging Het
Ecm2 A T 13: 49,524,446 K403* probably null Het
Eif3d T C 15: 77,959,724 N474S probably benign Het
Elf1 T C 14: 79,565,525 L106P probably damaging Het
Exoc4 G C 6: 33,296,922 probably null Het
F12 T C 13: 55,426,317 D34G probably benign Het
Fam214b A T 4: 43,036,441 S97T probably benign Het
Fam228b A T 12: 4,748,117 F200Y probably damaging Het
Fgl2 T A 5: 21,375,663 D334E possibly damaging Het
Fras1 T A 5: 96,776,622 F3641I probably benign Het
Gabrb2 T G 11: 42,593,847 Y244D probably damaging Het
Gcc1 A T 6: 28,421,269 D16E probably benign Het
Gga3 C A 11: 115,587,089 G558* probably null Het
Glt1d1 T C 5: 127,663,327 probably benign Het
Gm6614 T C 6: 141,990,421 T313A probably benign Het
Gorasp2 T C 2: 70,690,723 S346P possibly damaging Het
Hcn4 T C 9: 58,860,299 S1048P probably damaging Het
Henmt1 T A 3: 108,953,789 probably benign Het
Htt A C 5: 34,908,662 K3060N probably damaging Het
Ibsp C T 5: 104,302,158 L8F probably damaging Het
Kif27 A T 13: 58,303,564 D983E probably damaging Het
Kif3a T A 11: 53,590,733 probably benign Het
Kif3c A C 12: 3,367,090 K370N possibly damaging Het
Loxhd1 T C 18: 77,380,560 probably benign Het
Maz A T 7: 127,024,586 D74E probably damaging Het
Med21 T C 6: 146,650,234 S128P probably damaging Het
Mms19 A C 19: 41,955,168 M374R probably damaging Het
Mprip T C 11: 59,766,745 V801A probably damaging Het
Mrpl3 T C 9: 105,055,673 V111A probably benign Het
Mtfr2 T A 10: 20,348,412 Y31N probably damaging Het
Myh3 C T 11: 67,099,672 R1677C probably damaging Het
Mynn T A 3: 30,607,081 *61K probably null Het
Neb A C 2: 52,170,467 M2286R possibly damaging Het
Nr1i3 T A 1: 171,214,413 V22E probably damaging Het
Nxpe5 T C 5: 138,251,304 V452A probably damaging Het
Oas1e C A 5: 120,795,330 A57S probably benign Het
Olfr116 T A 17: 37,624,133 R167S probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A T 14: 50,533,694 K94M probably damaging Het
Pax3 A G 1: 78,103,504 L415P probably damaging Het
Pcnt G T 10: 76,369,821 probably benign Het
Peg3 G T 7: 6,711,673 D183E possibly damaging Het
Pglyrp1 G T 7: 18,889,388 G120V probably damaging Het
Pnp2 T A 14: 50,959,533 Y25* probably null Het
Pomt1 T A 2: 32,252,011 H584Q possibly damaging Het
Ppp1r12a A G 10: 108,253,332 N611D possibly damaging Het
Prkcq G A 2: 11,283,832 G532E probably benign Het
Prl6a1 A T 13: 27,317,997 I116F probably damaging Het
Ptprh T A 7: 4,573,362 T300S possibly damaging Het
Pwp1 A G 10: 85,885,616 T361A possibly damaging Het
Rab4a A T 8: 123,827,342 H5L probably damaging Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Ramp1 T C 1: 91,196,870 I51T possibly damaging Het
Raph1 G T 1: 60,525,899 T143K probably benign Het
Rhpn1 A G 15: 75,709,239 E110G possibly damaging Het
Rnf168 A T 16: 32,298,469 T283S possibly damaging Het
Ros1 T A 10: 52,101,761 Y1463F possibly damaging Het
Rtn4ip1 A G 10: 43,921,434 Q223R probably null Het
Rtp4 G T 16: 23,612,929 M70I probably benign Het
Sag C A 1: 87,834,618 T335K probably damaging Het
Satb1 T A 17: 51,740,346 Q647L probably benign Het
Sec31b T C 19: 44,520,408 probably benign Het
Sgo1 C T 17: 53,679,663 D167N probably damaging Het
Smchd1 T C 17: 71,431,236 I545V probably benign Het
St6gal1 G T 16: 23,321,141 A21S probably damaging Het
Stard9 C A 2: 120,699,819 L2186I probably damaging Het
Sun2 T A 15: 79,727,609 probably benign Het
Taf4 G A 2: 179,924,091 T849M probably damaging Het
Tdrd5 A T 1: 156,301,903 I79N probably damaging Het
Tdrd7 A G 4: 45,987,582 I72V probably damaging Het
Tnxb T A 17: 34,709,568 V2652E possibly damaging Het
Trim30a C T 7: 104,429,352 probably null Het
Tshz3 A G 7: 36,770,109 T508A probably damaging Het
Ttc21b A G 2: 66,223,564 L757P probably damaging Het
Ubtd2 A C 11: 32,499,223 probably null Het
Ubtd2 G T 11: 32,499,224 probably null Het
Vmn1r218 C T 13: 23,137,055 Q111* probably null Het
Vmn2r75 G A 7: 86,148,101 Q835* probably null Het
Vwa8 T A 14: 79,093,739 M1229K probably benign Het
Wdr76 C T 2: 121,519,451 R111C probably damaging Het
Xcr1 T A 9: 123,855,875 D274V possibly damaging Het
Ypel5 C T 17: 72,846,337 T12I probably benign Het
Other mutations in Ngf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Ngf APN 3 102520472 missense probably damaging 0.99
IGL01344:Ngf APN 3 102520312 missense probably benign 0.00
R0049:Ngf UTSW 3 102520345 nonsense probably null
R0147:Ngf UTSW 3 102509803 intron probably benign
R0148:Ngf UTSW 3 102509803 intron probably benign
R0149:Ngf UTSW 3 102520446 missense probably benign 0.13
R1769:Ngf UTSW 3 102520197 missense possibly damaging 0.87
R4357:Ngf UTSW 3 102520205 missense probably benign 0.22
R4486:Ngf UTSW 3 102520699 missense probably damaging 1.00
R4487:Ngf UTSW 3 102520699 missense probably damaging 1.00
R4488:Ngf UTSW 3 102520699 missense probably damaging 1.00
R4817:Ngf UTSW 3 102509840 intron probably benign
R4883:Ngf UTSW 3 102520645 missense probably damaging 1.00
R4938:Ngf UTSW 3 102520474 missense probably damaging 1.00
R5158:Ngf UTSW 3 102520129 missense possibly damaging 0.82
R5681:Ngf UTSW 3 102520353 missense probably damaging 1.00
R6259:Ngf UTSW 3 102509797 intron probably benign
R7790:Ngf UTSW 3 102509824 missense unknown
Predicted Primers PCR Primer
(F):5'- CCGTACACAGATAGCAATGTCCCAG -3'
(R):5'- TAATGTTCACCTCGGCCAGCAC -3'

Sequencing Primer
(F):5'- TGTCCCAGAAGGAGACTCTGTC -3'
(R):5'- TGACACTGTCACACACTGAG -3'
Posted On2013-05-23