Incidental Mutation 'R0049:Glt1d1'
Institutional Source Beutler Lab
Gene Symbol Glt1d1
Ensembl Gene ENSMUSG00000049971
Gene Nameglycosyltransferase 1 domain containing 1
MMRRC Submission 038343-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0049 (G1)
Quality Score225
Status Validated
Chromosomal Location127632262-127709374 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 127663327 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118139]
Predicted Effect probably benign
Transcript: ENSMUST00000118139
SMART Domains Protein: ENSMUSP00000113864
Gene: ENSMUSG00000049971

Pfam:Glycos_transf_1 153 319 8.2e-23 PFAM
Pfam:Glyco_trans_1_4 166 305 8.7e-15 PFAM
Pfam:Glyco_trans_1_2 244 335 8.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137157
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (114/115)
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,638,308 H9L possibly damaging Het
Aars T A 8: 111,052,451 I739K possibly damaging Het
Abcb1b T A 5: 8,825,661 H611Q probably damaging Het
Acod1 T A 14: 103,055,207 I389K possibly damaging Het
Adgre1 T A 17: 57,402,841 L166* probably null Het
Akap1 C A 11: 88,839,624 probably null Het
Akna T A 4: 63,394,635 Q417L probably damaging Het
Anxa7 T C 14: 20,462,610 D285G probably damaging Het
Arhgap1 T C 2: 91,670,169 Y308H probably damaging Het
Arhgef10 A C 8: 14,954,446 R360S probably damaging Het
Arhgef11 T A 3: 87,729,193 probably null Het
Arid3a A G 10: 79,931,065 T58A possibly damaging Het
Atp6v0a4 G A 6: 38,082,081 R256C probably damaging Het
Camsap3 C A 8: 3,598,772 S163R probably benign Het
Ccdc110 A T 8: 45,942,626 E518V probably damaging Het
Ccdc180 G A 4: 45,930,119 probably null Het
Ccnt1 T C 15: 98,565,079 M71V probably benign Het
Celsr2 T A 3: 108,397,254 Y2263F probably benign Het
Cfap36 A T 11: 29,246,514 probably null Het
Cfap69 T C 5: 5,613,734 T498A probably benign Het
Chadl T C 15: 81,694,012 D6G probably benign Het
Clstn3 T A 6: 124,459,853 I132F possibly damaging Het
Cnot4 A G 6: 35,051,277 V468A probably benign Het
Crmp1 T G 5: 37,265,273 D141E possibly damaging Het
Crtc1 A G 8: 70,391,859 probably null Het
Cryz C A 3: 154,611,552 A136D probably damaging Het
Dph6 A G 2: 114,523,044 V221A probably benign Het
Dst A T 1: 34,275,781 N4267Y probably damaging Het
Duox2 T A 2: 122,296,686 D170V possibly damaging Het
Ecm2 A T 13: 49,524,446 K403* probably null Het
Eif3d T C 15: 77,959,724 N474S probably benign Het
Elf1 T C 14: 79,565,525 L106P probably damaging Het
Exoc4 G C 6: 33,296,922 probably null Het
F12 T C 13: 55,426,317 D34G probably benign Het
Fam214b A T 4: 43,036,441 S97T probably benign Het
Fam228b A T 12: 4,748,117 F200Y probably damaging Het
Fgl2 T A 5: 21,375,663 D334E possibly damaging Het
Fras1 T A 5: 96,776,622 F3641I probably benign Het
Gabrb2 T G 11: 42,593,847 Y244D probably damaging Het
Gcc1 A T 6: 28,421,269 D16E probably benign Het
Gga3 C A 11: 115,587,089 G558* probably null Het
Gm6614 T C 6: 141,990,421 T313A probably benign Het
Gorasp2 T C 2: 70,690,723 S346P possibly damaging Het
Hcn4 T C 9: 58,860,299 S1048P probably damaging Het
Henmt1 T A 3: 108,953,789 probably benign Het
Htt A C 5: 34,908,662 K3060N probably damaging Het
Ibsp C T 5: 104,302,158 L8F probably damaging Het
Kif27 A T 13: 58,303,564 D983E probably damaging Het
Kif3a T A 11: 53,590,733 probably benign Het
Kif3c A C 12: 3,367,090 K370N possibly damaging Het
Loxhd1 T C 18: 77,380,560 probably benign Het
Maz A T 7: 127,024,586 D74E probably damaging Het
Med21 T C 6: 146,650,234 S128P probably damaging Het
Mms19 A C 19: 41,955,168 M374R probably damaging Het
Mprip T C 11: 59,766,745 V801A probably damaging Het
Mrpl3 T C 9: 105,055,673 V111A probably benign Het
Mtfr2 T A 10: 20,348,412 Y31N probably damaging Het
Myh3 C T 11: 67,099,672 R1677C probably damaging Het
Mynn T A 3: 30,607,081 *61K probably null Het
Neb A C 2: 52,170,467 M2286R possibly damaging Het
Ngf A T 3: 102,520,345 R137* probably null Het
Nr1i3 T A 1: 171,214,413 V22E probably damaging Het
Nxpe5 T C 5: 138,251,304 V452A probably damaging Het
Oas1e C A 5: 120,795,330 A57S probably benign Het
Olfr116 T A 17: 37,624,133 R167S probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A T 14: 50,533,694 K94M probably damaging Het
Pax3 A G 1: 78,103,504 L415P probably damaging Het
Pcnt G T 10: 76,369,821 probably benign Het
Peg3 G T 7: 6,711,673 D183E possibly damaging Het
Pglyrp1 G T 7: 18,889,388 G120V probably damaging Het
Pnp2 T A 14: 50,959,533 Y25* probably null Het
Pomt1 T A 2: 32,252,011 H584Q possibly damaging Het
Ppp1r12a A G 10: 108,253,332 N611D possibly damaging Het
Prkcq G A 2: 11,283,832 G532E probably benign Het
Prl6a1 A T 13: 27,317,997 I116F probably damaging Het
Ptprh T A 7: 4,573,362 T300S possibly damaging Het
Pwp1 A G 10: 85,885,616 T361A possibly damaging Het
Rab4a A T 8: 123,827,342 H5L probably damaging Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Ramp1 T C 1: 91,196,870 I51T possibly damaging Het
Raph1 G T 1: 60,525,899 T143K probably benign Het
Rhpn1 A G 15: 75,709,239 E110G possibly damaging Het
Rnf168 A T 16: 32,298,469 T283S possibly damaging Het
Ros1 T A 10: 52,101,761 Y1463F possibly damaging Het
Rtn4ip1 A G 10: 43,921,434 Q223R probably null Het
Rtp4 G T 16: 23,612,929 M70I probably benign Het
Sag C A 1: 87,834,618 T335K probably damaging Het
Satb1 T A 17: 51,740,346 Q647L probably benign Het
Sec31b T C 19: 44,520,408 probably benign Het
Sgo1 C T 17: 53,679,663 D167N probably damaging Het
Smchd1 T C 17: 71,431,236 I545V probably benign Het
St6gal1 G T 16: 23,321,141 A21S probably damaging Het
Stard9 C A 2: 120,699,819 L2186I probably damaging Het
Sun2 T A 15: 79,727,609 probably benign Het
Taf4 G A 2: 179,924,091 T849M probably damaging Het
Tdrd5 A T 1: 156,301,903 I79N probably damaging Het
Tdrd7 A G 4: 45,987,582 I72V probably damaging Het
Tnxb T A 17: 34,709,568 V2652E possibly damaging Het
Trim30a C T 7: 104,429,352 probably null Het
Tshz3 A G 7: 36,770,109 T508A probably damaging Het
Ttc21b A G 2: 66,223,564 L757P probably damaging Het
Ubtd2 A C 11: 32,499,223 probably null Het
Ubtd2 G T 11: 32,499,224 probably null Het
Vmn1r218 C T 13: 23,137,055 Q111* probably null Het
Vmn2r75 G A 7: 86,148,101 Q835* probably null Het
Vwa8 T A 14: 79,093,739 M1229K probably benign Het
Wdr76 C T 2: 121,519,451 R111C probably damaging Het
Xcr1 T A 9: 123,855,875 D274V possibly damaging Het
Ypel5 C T 17: 72,846,337 T12I probably benign Het
Other mutations in Glt1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Glt1d1 APN 5 127632285 start codon destroyed probably null 1.00
IGL01310:Glt1d1 APN 5 127632320 missense possibly damaging 0.86
IGL01608:Glt1d1 APN 5 127664682 missense possibly damaging 0.56
IGL01738:Glt1d1 APN 5 127632355 intron probably benign
IGL02028:Glt1d1 APN 5 127706920 missense possibly damaging 0.63
IGL02273:Glt1d1 APN 5 127657144 splice site probably benign
IGL02603:Glt1d1 APN 5 127632345 missense probably damaging 1.00
IGL02718:Glt1d1 APN 5 127650699 missense probably damaging 0.98
IGL02850:Glt1d1 APN 5 127644345 missense probably benign 0.00
IGL03328:Glt1d1 APN 5 127657119 missense probably benign
R0312:Glt1d1 UTSW 5 127691070 missense probably damaging 1.00
R0400:Glt1d1 UTSW 5 127657075 splice site probably benign
R1838:Glt1d1 UTSW 5 127678129 missense probably benign 0.01
R2060:Glt1d1 UTSW 5 127657119 missense probably benign
R2262:Glt1d1 UTSW 5 127657112 missense probably benign 0.08
R3776:Glt1d1 UTSW 5 127694311 missense probably damaging 1.00
R4205:Glt1d1 UTSW 5 127689871 missense probably benign 0.32
R4249:Glt1d1 UTSW 5 127691112 critical splice donor site probably null
R4379:Glt1d1 UTSW 5 127694282 missense possibly damaging 0.73
R5044:Glt1d1 UTSW 5 127644414 missense probably benign 0.38
R5289:Glt1d1 UTSW 5 127644356 missense probably benign 0.11
R5374:Glt1d1 UTSW 5 127657084 splice site probably null
R5533:Glt1d1 UTSW 5 127691031 missense probably damaging 1.00
R5592:Glt1d1 UTSW 5 127657119 missense probably benign 0.01
R5870:Glt1d1 UTSW 5 127677280 missense probably damaging 1.00
R5942:Glt1d1 UTSW 5 127644470 splice site probably null
R6128:Glt1d1 UTSW 5 127677271 missense probably damaging 1.00
R6349:Glt1d1 UTSW 5 127706886 missense probably benign 0.10
R6490:Glt1d1 UTSW 5 127644296 intron probably null
R6502:Glt1d1 UTSW 5 127706981 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- accaagtcctgaaagttgtcc -3'
Posted On2013-05-23