Incidental Mutation 'R0049:Camsap3'
ID40891
Institutional Source Beutler Lab
Gene Symbol Camsap3
Ensembl Gene ENSMUSG00000044433
Gene Namecalmodulin regulated spectrin-associated protein family, member 3
SynonymsNezha, 2310057J16Rik
MMRRC Submission 038343-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R0049 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location3587293-3609075 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 3598772 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 163 (S163R)
Ref Sequence ENSEMBL: ENSMUSP00000146359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057028] [ENSMUST00000171962] [ENSMUST00000207077] [ENSMUST00000207432] [ENSMUST00000207533] [ENSMUST00000207712] [ENSMUST00000207970] [ENSMUST00000208036] [ENSMUST00000208240]
Predicted Effect probably benign
Transcript: ENSMUST00000057028
AA Change: S163R

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000058958
Gene: ENSMUSG00000044433
AA Change: S163R

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CH 166 315 5.5e-27 PFAM
Pfam:CAMSAP_CH 214 296 1.2e-29 PFAM
low complexity region 359 373 N/A INTRINSIC
coiled coil region 595 633 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
coiled coil region 696 727 N/A INTRINSIC
low complexity region 749 779 N/A INTRINSIC
low complexity region 828 837 N/A INTRINSIC
low complexity region 866 881 N/A INTRINSIC
coiled coil region 900 943 N/A INTRINSIC
low complexity region 944 965 N/A INTRINSIC
low complexity region 1002 1024 N/A INTRINSIC
CAMSAP_CKK 1111 1240 1.29e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171962
AA Change: S163R

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125993
Gene: ENSMUSG00000044433
AA Change: S163R

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CAMSAP_CH 214 296 6e-31 PFAM
low complexity region 360 374 N/A INTRINSIC
Pfam:CAMSAP_CC1 587 645 1.1e-27 PFAM
low complexity region 646 656 N/A INTRINSIC
coiled coil region 697 728 N/A INTRINSIC
low complexity region 750 780 N/A INTRINSIC
low complexity region 829 838 N/A INTRINSIC
low complexity region 867 882 N/A INTRINSIC
coiled coil region 901 944 N/A INTRINSIC
low complexity region 945 966 N/A INTRINSIC
low complexity region 1003 1025 N/A INTRINSIC
CAMSAP_CKK 1112 1241 1.29e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207077
AA Change: S163R

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000207432
AA Change: S163R

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000207533
AA Change: S163R

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000207712
AA Change: S163R

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207930
Predicted Effect probably benign
Transcript: ENSMUST00000207970
AA Change: S163R

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000208036
AA Change: S30R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208064
Predicted Effect probably benign
Transcript: ENSMUST00000208240
AA Change: S163R

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 99% (114/115)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display variable penetrance of vascular, liver, nervous system, rib and eye abnormalities. Mice homozygous for an allele with loss of microtubule binding show partial lethality, decreased body size and abnormal alignment of microtubles in polarized epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,638,308 H9L possibly damaging Het
Aars T A 8: 111,052,451 I739K possibly damaging Het
Abcb1b T A 5: 8,825,661 H611Q probably damaging Het
Acod1 T A 14: 103,055,207 I389K possibly damaging Het
Adgre1 T A 17: 57,402,841 L166* probably null Het
Akap1 C A 11: 88,839,624 probably null Het
Akna T A 4: 63,394,635 Q417L probably damaging Het
Anxa7 T C 14: 20,462,610 D285G probably damaging Het
Arhgap1 T C 2: 91,670,169 Y308H probably damaging Het
Arhgef10 A C 8: 14,954,446 R360S probably damaging Het
Arhgef11 T A 3: 87,729,193 probably null Het
Arid3a A G 10: 79,931,065 T58A possibly damaging Het
Atp6v0a4 G A 6: 38,082,081 R256C probably damaging Het
Ccdc110 A T 8: 45,942,626 E518V probably damaging Het
Ccdc180 G A 4: 45,930,119 probably null Het
Ccnt1 T C 15: 98,565,079 M71V probably benign Het
Celsr2 T A 3: 108,397,254 Y2263F probably benign Het
Cfap36 A T 11: 29,246,514 probably null Het
Cfap69 T C 5: 5,613,734 T498A probably benign Het
Chadl T C 15: 81,694,012 D6G probably benign Het
Clstn3 T A 6: 124,459,853 I132F possibly damaging Het
Cnot4 A G 6: 35,051,277 V468A probably benign Het
Crmp1 T G 5: 37,265,273 D141E possibly damaging Het
Crtc1 A G 8: 70,391,859 probably null Het
Cryz C A 3: 154,611,552 A136D probably damaging Het
Dph6 A G 2: 114,523,044 V221A probably benign Het
Dst A T 1: 34,275,781 N4267Y probably damaging Het
Duox2 T A 2: 122,296,686 D170V possibly damaging Het
Ecm2 A T 13: 49,524,446 K403* probably null Het
Eif3d T C 15: 77,959,724 N474S probably benign Het
Elf1 T C 14: 79,565,525 L106P probably damaging Het
Exoc4 G C 6: 33,296,922 probably null Het
F12 T C 13: 55,426,317 D34G probably benign Het
Fam214b A T 4: 43,036,441 S97T probably benign Het
Fam228b A T 12: 4,748,117 F200Y probably damaging Het
Fgl2 T A 5: 21,375,663 D334E possibly damaging Het
Fras1 T A 5: 96,776,622 F3641I probably benign Het
Gabrb2 T G 11: 42,593,847 Y244D probably damaging Het
Gcc1 A T 6: 28,421,269 D16E probably benign Het
Gga3 C A 11: 115,587,089 G558* probably null Het
Glt1d1 T C 5: 127,663,327 probably benign Het
Gm6614 T C 6: 141,990,421 T313A probably benign Het
Gorasp2 T C 2: 70,690,723 S346P possibly damaging Het
Hcn4 T C 9: 58,860,299 S1048P probably damaging Het
Henmt1 T A 3: 108,953,789 probably benign Het
Htt A C 5: 34,908,662 K3060N probably damaging Het
Ibsp C T 5: 104,302,158 L8F probably damaging Het
Kif27 A T 13: 58,303,564 D983E probably damaging Het
Kif3a T A 11: 53,590,733 probably benign Het
Kif3c A C 12: 3,367,090 K370N possibly damaging Het
Loxhd1 T C 18: 77,380,560 probably benign Het
Maz A T 7: 127,024,586 D74E probably damaging Het
Med21 T C 6: 146,650,234 S128P probably damaging Het
Mms19 A C 19: 41,955,168 M374R probably damaging Het
Mprip T C 11: 59,766,745 V801A probably damaging Het
Mrpl3 T C 9: 105,055,673 V111A probably benign Het
Mtfr2 T A 10: 20,348,412 Y31N probably damaging Het
Myh3 C T 11: 67,099,672 R1677C probably damaging Het
Mynn T A 3: 30,607,081 *61K probably null Het
Neb A C 2: 52,170,467 M2286R possibly damaging Het
Ngf A T 3: 102,520,345 R137* probably null Het
Nr1i3 T A 1: 171,214,413 V22E probably damaging Het
Nxpe5 T C 5: 138,251,304 V452A probably damaging Het
Oas1e C A 5: 120,795,330 A57S probably benign Het
Olfr116 T A 17: 37,624,133 R167S probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A T 14: 50,533,694 K94M probably damaging Het
Pax3 A G 1: 78,103,504 L415P probably damaging Het
Pcnt G T 10: 76,369,821 probably benign Het
Peg3 G T 7: 6,711,673 D183E possibly damaging Het
Pglyrp1 G T 7: 18,889,388 G120V probably damaging Het
Pnp2 T A 14: 50,959,533 Y25* probably null Het
Pomt1 T A 2: 32,252,011 H584Q possibly damaging Het
Ppp1r12a A G 10: 108,253,332 N611D possibly damaging Het
Prkcq G A 2: 11,283,832 G532E probably benign Het
Prl6a1 A T 13: 27,317,997 I116F probably damaging Het
Ptprh T A 7: 4,573,362 T300S possibly damaging Het
Pwp1 A G 10: 85,885,616 T361A possibly damaging Het
Rab4a A T 8: 123,827,342 H5L probably damaging Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Ramp1 T C 1: 91,196,870 I51T possibly damaging Het
Raph1 G T 1: 60,525,899 T143K probably benign Het
Rhpn1 A G 15: 75,709,239 E110G possibly damaging Het
Rnf168 A T 16: 32,298,469 T283S possibly damaging Het
Ros1 T A 10: 52,101,761 Y1463F possibly damaging Het
Rtn4ip1 A G 10: 43,921,434 Q223R probably null Het
Rtp4 G T 16: 23,612,929 M70I probably benign Het
Sag C A 1: 87,834,618 T335K probably damaging Het
Satb1 T A 17: 51,740,346 Q647L probably benign Het
Sec31b T C 19: 44,520,408 probably benign Het
Sgo1 C T 17: 53,679,663 D167N probably damaging Het
Smchd1 T C 17: 71,431,236 I545V probably benign Het
St6gal1 G T 16: 23,321,141 A21S probably damaging Het
Stard9 C A 2: 120,699,819 L2186I probably damaging Het
Sun2 T A 15: 79,727,609 probably benign Het
Taf4 G A 2: 179,924,091 T849M probably damaging Het
Tdrd5 A T 1: 156,301,903 I79N probably damaging Het
Tdrd7 A G 4: 45,987,582 I72V probably damaging Het
Tnxb T A 17: 34,709,568 V2652E possibly damaging Het
Trim30a C T 7: 104,429,352 probably null Het
Tshz3 A G 7: 36,770,109 T508A probably damaging Het
Ttc21b A G 2: 66,223,564 L757P probably damaging Het
Ubtd2 A C 11: 32,499,223 probably null Het
Ubtd2 G T 11: 32,499,224 probably null Het
Vmn1r218 C T 13: 23,137,055 Q111* probably null Het
Vmn2r75 G A 7: 86,148,101 Q835* probably null Het
Vwa8 T A 14: 79,093,739 M1229K probably benign Het
Wdr76 C T 2: 121,519,451 R111C probably damaging Het
Xcr1 T A 9: 123,855,875 D274V possibly damaging Het
Ypel5 C T 17: 72,846,337 T12I probably benign Het
Other mutations in Camsap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Camsap3 APN 8 3602077 missense probably damaging 1.00
IGL00797:Camsap3 APN 8 3602115 splice site probably benign
IGL01457:Camsap3 APN 8 3604795 missense probably damaging 0.98
IGL01833:Camsap3 APN 8 3608508 missense probably damaging 1.00
IGL02095:Camsap3 APN 8 3603845 missense probably damaging 1.00
IGL02880:Camsap3 APN 8 3603913 missense probably damaging 1.00
R0005:Camsap3 UTSW 8 3604288 missense probably damaging 1.00
R0049:Camsap3 UTSW 8 3598772 missense probably benign 0.11
R0347:Camsap3 UTSW 8 3602029 missense probably damaging 1.00
R0926:Camsap3 UTSW 8 3587960 critical splice donor site probably null
R0946:Camsap3 UTSW 8 3604442 missense probably benign 0.00
R1169:Camsap3 UTSW 8 3603866 missense probably damaging 1.00
R1206:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1207:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1207:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1454:Camsap3 UTSW 8 3603968 missense possibly damaging 0.58
R1475:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1581:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1618:Camsap3 UTSW 8 3598740 missense probably benign 0.25
R1820:Camsap3 UTSW 8 3603485 missense probably damaging 1.00
R1899:Camsap3 UTSW 8 3603922 nonsense probably null
R1914:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1952:Camsap3 UTSW 8 3604789 missense probably damaging 0.99
R2338:Camsap3 UTSW 8 3606808 missense probably damaging 1.00
R3725:Camsap3 UTSW 8 3603785 missense probably damaging 1.00
R3726:Camsap3 UTSW 8 3603785 missense probably damaging 1.00
R4528:Camsap3 UTSW 8 3606515 missense possibly damaging 0.79
R4652:Camsap3 UTSW 8 3600689 missense possibly damaging 0.87
R5025:Camsap3 UTSW 8 3604244 missense probably damaging 1.00
R5120:Camsap3 UTSW 8 3600680 missense probably damaging 0.97
R5381:Camsap3 UTSW 8 3603812 missense probably damaging 1.00
R5388:Camsap3 UTSW 8 3604276 missense probably damaging 1.00
R5829:Camsap3 UTSW 8 3597899 missense probably damaging 1.00
R5846:Camsap3 UTSW 8 3603980 missense probably damaging 1.00
R5935:Camsap3 UTSW 8 3601999 missense probably damaging 1.00
R6363:Camsap3 UTSW 8 3601971 missense probably damaging 1.00
R6469:Camsap3 UTSW 8 3603941 missense possibly damaging 0.79
R6595:Camsap3 UTSW 8 3604186 missense probably damaging 1.00
R6595:Camsap3 UTSW 8 3608742 missense probably damaging 1.00
R7024:Camsap3 UTSW 8 3608242 missense probably damaging 0.98
R7062:Camsap3 UTSW 8 3607834 unclassified probably benign
R7109:Camsap3 UTSW 8 3598087 missense possibly damaging 0.53
R7233:Camsap3 UTSW 8 3600371 missense probably damaging 0.99
R7236:Camsap3 UTSW 8 3604116 missense probably damaging 1.00
R7316:Camsap3 UTSW 8 3604648 missense possibly damaging 0.51
R7340:Camsap3 UTSW 8 3587960 critical splice donor site probably null
R7512:Camsap3 UTSW 8 3598740 missense probably benign 0.25
R7779:Camsap3 UTSW 8 3597887 missense probably damaging 1.00
R8134:Camsap3 UTSW 8 3598075 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGTCTTAGCTCAAAACCCAGCCC -3'
(R):5'- CTCACTTACAGGAACCAGCTTCCAG -3'

Sequencing Primer
(F):5'- ATAACTGTAGCTCTCAAGGTCC -3'
(R):5'- ccatccatccatccatccatc -3'
Posted On2013-05-23