Incidental Mutation 'R0054:Farsb'
ID40949
Institutional Source Beutler Lab
Gene Symbol Farsb
Ensembl Gene ENSMUSG00000026245
Gene Namephenylalanyl-tRNA synthetase, beta subunit
SynonymsFarsl, Frsb, PheRS alpha, Farslb
MMRRC Submission 038348-MU
Accession Numbers

Ncbi RefSeq: NM_011811.3; MGI: 1346035

Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R0054 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location78417975-78488897 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 78462374 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 395 (K395*)
Ref Sequence ENSEMBL: ENSMUSP00000129828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068333] [ENSMUST00000170217] [ENSMUST00000188247] [ENSMUST00000189529]
Predicted Effect probably null
Transcript: ENSMUST00000068333
AA Change: K395*
SMART Domains Protein: ENSMUSP00000069508
Gene: ENSMUSG00000026245
AA Change: K395*

DomainStartEndE-ValueType
Blast:B3_4 56 95 6e-14 BLAST
B3_4 117 279 3.29e-29 SMART
B5 304 374 6.31e-17 SMART
SCOP:d1jjcb5 377 586 1e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170217
AA Change: K395*
SMART Domains Protein: ENSMUSP00000129828
Gene: ENSMUSG00000026245
AA Change: K395*

DomainStartEndE-ValueType
Blast:B3_4 56 95 6e-14 BLAST
B3_4 117 279 3.29e-29 SMART
B5 304 374 6.31e-17 SMART
SCOP:d1jjcb5 377 586 1e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188247
SMART Domains Protein: ENSMUSP00000139933
Gene: ENSMUSG00000026245

DomainStartEndE-ValueType
B3_4 18 180 2.5e-33 SMART
SCOP:d1jjcb2 204 237 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189529
SMART Domains Protein: ENSMUSP00000140001
Gene: ENSMUSG00000026245

DomainStartEndE-ValueType
PDB:3L4G|P 1 38 3e-20 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195509
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved enzyme that belongs to the aminoacyl-tRNA synthetase class IIc subfamily. This enzyme comprises the regulatory beta subunits that form a tetramer with two catalytic alpha subunits. In the presence of ATP, this tetramer is responsible for attaching L-phenylalanine to the terminal adenosine of the appropriate tRNA. A pseudogene located on chromosome 10 has been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI

All alleles(15) : Targeted(2) Gene trapped(13)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,601,774 probably null Het
Ahnak T A 19: 9,012,056 V3568E probably damaging Het
Alpi T C 1: 87,099,765 E293G possibly damaging Het
Apoa4 A G 9: 46,242,524 D141G probably benign Het
Arntl2 T G 6: 146,829,718 V507G probably benign Het
Atg9a T C 1: 75,184,499 Y701C probably damaging Het
Baz2b C T 2: 59,932,166 R922Q probably damaging Het
Bpnt1 G A 1: 185,341,216 probably benign Het
Brms1 T A 19: 5,046,699 C136* probably null Het
Ccdc129 T C 6: 55,872,472 probably benign Het
Ccdc180 T A 4: 45,890,900 V24E probably benign Het
Cdh17 A G 4: 11,785,186 Y326C possibly damaging Het
Cgn A T 3: 94,762,592 D1080E possibly damaging Het
Clec4f C T 6: 83,652,929 V216M probably benign Het
Cpd C G 11: 76,790,838 G1160R probably damaging Het
Csf2ra A G 19: 61,226,597 L143P probably damaging Het
Ddb2 G T 2: 91,234,820 Q87K probably benign Het
Defb41 A G 1: 18,251,247 Y48H probably damaging Het
Dido1 T C 2: 180,661,474 N1546D probably benign Het
Dll1 A T 17: 15,368,954 H486Q probably damaging Het
Dmac1 A G 4: 75,278,100 V51A possibly damaging Het
Dnajb11 C T 16: 22,862,619 A49V probably damaging Het
Dnajc14 G A 10: 128,807,579 D457N probably damaging Het
Eif3a C A 19: 60,766,826 D973Y unknown Het
Entpd3 T A 9: 120,557,542 N196K probably damaging Het
Fam53a C A 5: 33,607,732 G210V probably damaging Het
Fem1b A G 9: 62,796,800 S393P probably damaging Het
Fsip2 T A 2: 82,976,608 D1090E probably damaging Het
Fsip2 A C 2: 82,986,955 N4344T possibly damaging Het
Gata3 G A 2: 9,858,447 P419S probably damaging Het
Gm13023 T A 4: 143,795,002 L396H probably damaging Het
Gm7247 T A 14: 51,569,600 probably benign Het
Gphn A G 12: 78,637,503 S558G probably damaging Het
Gpr142 C A 11: 114,798,929 H2Q probably benign Het
Grhpr T C 4: 44,988,915 probably benign Het
Grik3 C A 4: 125,623,575 N70K probably damaging Het
Gsap T A 5: 21,250,935 probably benign Het
Iars T A 13: 49,693,135 C237S probably damaging Het
Kank2 G A 9: 21,774,674 R635* probably null Het
Kcnj16 G T 11: 111,024,723 W70C probably damaging Het
Kpna6 T C 4: 129,657,458 M85V probably benign Het
Kri1 G A 9: 21,275,365 S447L probably damaging Het
L2hgdh G A 12: 69,721,331 P131L possibly damaging Het
Lrp1b A G 2: 40,742,817 V3528A probably benign Het
Lrrc46 A T 11: 97,038,779 L77Q probably damaging Het
Mdc1 A G 17: 35,849,033 T678A probably benign Het
Mrpl44 T C 1: 79,779,495 L219S probably damaging Het
Myo7a T C 7: 98,065,698 D112G probably damaging Het
Ncoa3 A G 2: 166,055,178 T630A possibly damaging Het
Nsl1 T C 1: 191,082,184 L194P probably damaging Het
Olfr1037 T C 2: 86,085,361 K139E probably benign Het
Olfr1285 G A 2: 111,408,795 G127S probably benign Het
Olfr205 T C 16: 59,329,065 Y148C possibly damaging Het
Pde4d A G 13: 109,740,421 S159G probably benign Het
Pi4ka T C 16: 17,325,114 R845G probably null Het
Pld1 A G 3: 28,095,884 probably benign Het
Psd T A 19: 46,323,342 I300F probably damaging Het
Ptprz1 T A 6: 22,986,196 W332R probably damaging Het
Rab3d A T 9: 21,915,926 S3T possibly damaging Het
Rnf212 T A 5: 108,745,664 M70L possibly damaging Het
Scd3 A G 19: 44,215,637 Y88C probably damaging Het
Sema4f A G 6: 82,919,693 probably benign Het
Sez6 C A 11: 77,953,873 T7K possibly damaging Het
Skint2 T C 4: 112,645,463 I290T probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc5a3 T A 16: 92,077,634 I193N probably damaging Het
Slc5a4a A G 10: 76,178,197 I413V probably null Het
Snip1 T A 4: 125,072,840 Y354* probably null Het
Spata31d1c A G 13: 65,033,062 probably benign Het
Speer2 G A 16: 69,858,752 T62M probably damaging Het
Tmco5 A G 2: 116,887,287 Y200C probably damaging Het
Tmem87b T A 2: 128,831,441 probably benign Het
Trim43c A T 9: 88,847,515 K336N probably damaging Het
Trim60 T C 8: 65,001,321 E92G probably benign Het
Ttc21a C A 9: 119,943,940 Q228K probably damaging Het
Ttn A T 2: 76,796,460 D13067E possibly damaging Het
Ufl1 A T 4: 25,269,087 I168N probably damaging Het
Vmn1r167 T G 7: 23,504,909 R227S possibly damaging Het
Vmn2r25 T A 6: 123,853,025 I56L probably benign Het
Zfp385c G A 11: 100,629,956 P293S probably benign Het
Zfp473 T A 7: 44,734,475 S144C probably damaging Het
Other mutations in Farsb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Farsb APN 1 78462993 missense probably benign 0.08
IGL01328:Farsb APN 1 78471092 missense probably benign 0.02
IGL01801:Farsb APN 1 78458579 missense probably benign 0.38
R0054:Farsb UTSW 1 78462374 nonsense probably null
R1051:Farsb UTSW 1 78443650 missense possibly damaging 0.49
R1769:Farsb UTSW 1 78466983 missense probably benign 0.06
R4332:Farsb UTSW 1 78469266 missense possibly damaging 0.61
R4664:Farsb UTSW 1 78443765 missense possibly damaging 0.90
R4796:Farsb UTSW 1 78425196 makesense probably null
R4859:Farsb UTSW 1 78467972 missense probably benign 0.01
R5484:Farsb UTSW 1 78476196 missense probably damaging 1.00
R5500:Farsb UTSW 1 78471124 missense probably damaging 1.00
R5557:Farsb UTSW 1 78469251 critical splice donor site probably null
R6109:Farsb UTSW 1 78463270 critical splice donor site probably null
R6368:Farsb UTSW 1 78466965 critical splice donor site probably null
R6720:Farsb UTSW 1 78472497 missense probably damaging 1.00
R7166:Farsb UTSW 1 78471184 missense probably benign
R7184:Farsb UTSW 1 78482357 missense possibly damaging 0.86
R7233:Farsb UTSW 1 78471081 critical splice donor site probably null
R7536:Farsb UTSW 1 78443754 missense possibly damaging 0.89
R7753:Farsb UTSW 1 78480103 missense probably benign 0.25
R7824:Farsb UTSW 1 78469299 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTAACCGGGGCGGTATCTAGTGAG -3'
(R):5'- AGGACACATTTCCAGTGTGGAGCG -3'

Sequencing Primer
(F):5'- CGGTATCTAGTGAGTACAGCCAC -3'
(R):5'- GCTGGTTGACTCTAACCGTAAG -3'
Posted On2013-05-23