Mutagenetix > Incidental Mutations

Incidental Mutation 'R0054:Nsl1'

40953

Institutional Source

Beutler Lab

Gene Symbol

Nsl1

Ensembl Gene

ENSMUSG00000062510

Gene Name

NSL1, MIS12 kinetochore complex component

Synonyms

LOC381318, 4833432M17Rik

MMRRC Submission

038348-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.938) question?

Stock #

R0054 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

191063012-191086474 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 191082184 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 194 (L194P)

Ref Sequence

ENSEMBL: ENSMUSP00000077380 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078259]

Predicted Effect

probably damaging
Transcript: ENSMUST00000078259
AA Change: L194P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077380
Gene: ENSMUSG00000062510
AA Change: L194P

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:Mis14	82	197	2.9e-26	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192879

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.9%
20x: 94.5%

Validation Efficiency

99% (83/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two coiled-coil domains that localizes to kinetochores, which are chromosome-associated structures that attach to microtubules and mediate chromosome movements during cell division. The encoded protein is part of a conserved protein complex that includes two chromodomain-containing proteins and a component of the outer plate of the kinetochore. This protein complex is proposed to bridge centromeric heterochromatin with the outer kinetochore structure. Multiple transcript variants encoding different isoforms have been found for this gene. There is a pseudogene of the 3' UTR region of this gene on chromosome X. [provided by RefSeq, Jul 2014]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	A	G	6: 142,601,774		probably null	Het
Ahnak	T	A	19: 9,012,056	V3568E	probably damaging	Het
Alpi	T	C	1: 87,099,765	E293G	possibly damaging	Het
Apoa4	A	G	9: 46,242,524	D141G	probably benign	Het
Arntl2	T	G	6: 146,829,718	V507G	probably benign	Het
Atg9a	T	C	1: 75,184,499	Y701C	probably damaging	Het
Baz2b	C	T	2: 59,932,166	R922Q	probably damaging	Het
Bpnt1	G	A	1: 185,341,216		probably benign	Het
Brms1	T	A	19: 5,046,699	C136*	probably null	Het
Ccdc129	T	C	6: 55,872,472		probably benign	Het
Ccdc180	T	A	4: 45,890,900	V24E	probably benign	Het
Cdh17	A	G	4: 11,785,186	Y326C	possibly damaging	Het
Cgn	A	T	3: 94,762,592	D1080E	possibly damaging	Het
Clec4f	C	T	6: 83,652,929	V216M	probably benign	Het
Cpd	C	G	11: 76,790,838	G1160R	probably damaging	Het
Csf2ra	A	G	19: 61,226,597	L143P	probably damaging	Het
Ddb2	G	T	2: 91,234,820	Q87K	probably benign	Het
Defb41	A	G	1: 18,251,247	Y48H	probably damaging	Het
Dido1	T	C	2: 180,661,474	N1546D	probably benign	Het
Dll1	A	T	17: 15,368,954	H486Q	probably damaging	Het
Dmac1	A	G	4: 75,278,100	V51A	possibly damaging	Het
Dnajb11	C	T	16: 22,862,619	A49V	probably damaging	Het
Dnajc14	G	A	10: 128,807,579	D457N	probably damaging	Het
Eif3a	C	A	19: 60,766,826	D973Y	unknown	Het
Entpd3	T	A	9: 120,557,542	N196K	probably damaging	Het
Fam53a	C	A	5: 33,607,732	G210V	probably damaging	Het
Farsb	T	A	1: 78,462,374	K395*	probably null	Het
Fem1b	A	G	9: 62,796,800	S393P	probably damaging	Het
Fsip2	A	C	2: 82,986,955	N4344T	possibly damaging	Het
Fsip2	T	A	2: 82,976,608	D1090E	probably damaging	Het
Gata3	G	A	2: 9,858,447	P419S	probably damaging	Het
Gm13023	T	A	4: 143,795,002	L396H	probably damaging	Het
Gm7247	T	A	14: 51,569,600		probably benign	Het
Gphn	A	G	12: 78,637,503	S558G	probably damaging	Het
Gpr142	C	A	11: 114,798,929	H2Q	probably benign	Het
Grhpr	T	C	4: 44,988,915		probably benign	Het
Grik3	C	A	4: 125,623,575	N70K	probably damaging	Het
Gsap	T	A	5: 21,250,935		probably benign	Het
Iars	T	A	13: 49,693,135	C237S	probably damaging	Het
Kank2	G	A	9: 21,774,674	R635*	probably null	Het
Kcnj16	G	T	11: 111,024,723	W70C	probably damaging	Het
Kpna6	T	C	4: 129,657,458	M85V	probably benign	Het
Kri1	G	A	9: 21,275,365	S447L	probably damaging	Het
L2hgdh	G	A	12: 69,721,331	P131L	possibly damaging	Het
Lrp1b	A	G	2: 40,742,817	V3528A	probably benign	Het
Lrrc46	A	T	11: 97,038,779	L77Q	probably damaging	Het
Mdc1	A	G	17: 35,849,033	T678A	probably benign	Het
Mrpl44	T	C	1: 79,779,495	L219S	probably damaging	Het
Myo7a	T	C	7: 98,065,698	D112G	probably damaging	Het
Ncoa3	A	G	2: 166,055,178	T630A	possibly damaging	Het
Olfr1037	T	C	2: 86,085,361	K139E	probably benign	Het
Olfr1285	G	A	2: 111,408,795	G127S	probably benign	Het
Olfr205	T	C	16: 59,329,065	Y148C	possibly damaging	Het
Pde4d	A	G	13: 109,740,421	S159G	probably benign	Het
Pi4ka	T	C	16: 17,325,114	R845G	probably null	Het
Pld1	A	G	3: 28,095,884		probably benign	Het
Psd	T	A	19: 46,323,342	I300F	probably damaging	Het
Ptprz1	T	A	6: 22,986,196	W332R	probably damaging	Het
Rab3d	A	T	9: 21,915,926	S3T	possibly damaging	Het
Rnf212	T	A	5: 108,745,664	M70L	possibly damaging	Het
Scd3	A	G	19: 44,215,637	Y88C	probably damaging	Het
Sema4f	A	G	6: 82,919,693		probably benign	Het
Sez6	C	A	11: 77,953,873	T7K	possibly damaging	Het
Skint2	T	C	4: 112,645,463	I290T	probably benign	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Slc4a4	A	C	5: 89,156,336	H502P	possibly damaging	Het
Slc5a3	T	A	16: 92,077,634	I193N	probably damaging	Het
Slc5a4a	A	G	10: 76,178,197	I413V	probably null	Het
Snip1	T	A	4: 125,072,840	Y354*	probably null	Het
Spata31d1c	A	G	13: 65,033,062		probably benign	Het
Speer2	G	A	16: 69,858,752	T62M	probably damaging	Het
Tmco5	A	G	2: 116,887,287	Y200C	probably damaging	Het
Tmem87b	T	A	2: 128,831,441		probably benign	Het
Trim43c	A	T	9: 88,847,515	K336N	probably damaging	Het
Trim60	T	C	8: 65,001,321	E92G	probably benign	Het
Ttc21a	C	A	9: 119,943,940	Q228K	probably damaging	Het
Ttn	A	T	2: 76,796,460	D13067E	possibly damaging	Het
Ufl1	A	T	4: 25,269,087	I168N	probably damaging	Het
Vmn1r167	T	G	7: 23,504,909	R227S	possibly damaging	Het
Vmn2r25	T	A	6: 123,853,025	I56L	probably benign	Het
Zfp385c	G	A	11: 100,629,956	P293S	probably benign	Het
Zfp473	T	A	7: 44,734,475	S144C	probably damaging	Het

Other mutations in Nsl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02546:Nsl1	APN	1	191071201	missense	probably benign	0.06
IGL03398:Nsl1	APN	1	191082164	splice site	probably benign
IGL02988:Nsl1	UTSW	1	191063103	nonsense	probably null
R0054:Nsl1	UTSW	1	191082184	missense	probably damaging	1.00
R0284:Nsl1	UTSW	1	191065230	missense	probably damaging	1.00
R0482:Nsl1	UTSW	1	191063040	start codon destroyed	probably null	0.83
R1776:Nsl1	UTSW	1	191063188	missense	probably benign
R5187:Nsl1	UTSW	1	191075190	missense	probably benign	0.01
R5470:Nsl1	UTSW	1	191080540	missense	probably benign	0.24
R5838:Nsl1	UTSW	1	191070113	missense	probably benign	0.02
R6133:Nsl1	UTSW	1	191071206	missense	probably damaging	0.99
R6636:Nsl1	UTSW	1	191075127	missense	probably benign	0.00
R6817:Nsl1	UTSW	1	191063274	critical splice donor site	probably null
R7755:Nsl1	UTSW	1	191063183	missense	probably benign	0.21
Z1177:Nsl1	UTSW	1	191063231	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGGAATGAGCCACGTCTTCTGAG -3'
(R):5'- AGGCATCAGACTGTGACCCAAATG -3'

Sequencing Primer
(F):5'- GCCACGTCTTCTGAGTCTGAG -3'
(R):5'- CTTTAGCACAATGTCGGAGGC -3'

Posted On

2013-05-23