Mutagenetix > Incidental Mutations

Incidental Mutation 'R0054:Olfr1285'

40962

Institutional Source

Beutler Lab

Gene Symbol

Olfr1285

Ensembl Gene

ENSMUSG00000062280

Gene Name

olfactory receptor 1285

Synonyms

MOR248-17P, MOR248-25_p, GA_x6K02T2Q125-72459956-72460837

MMRRC Submission

038348-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.078) question?

Stock #

R0054 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

111408376-111409331 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 111408795 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 127 (G127S)

Gene Model

predicted gene model for transcript(s):

Predicted Effect

probably benign
Transcript: ENSMUST00000150164
AA Change: G127S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000121467
Gene: ENSMUSG00000062280
AA Change: G127S

Domain	Start	End	E-Value	Type
Pfam:7tm_4	24	293	2.9e-40	PFAM
Pfam:7tm_1	34	280	1.8e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208523

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220153

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.9%
20x: 94.5%

Validation Efficiency

99% (83/84)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	A	G	6: 142,601,774		probably null	Het
Ahnak	T	A	19: 9,012,056	V3568E	probably damaging	Het
Alpi	T	C	1: 87,099,765	E293G	possibly damaging	Het
Apoa4	A	G	9: 46,242,524	D141G	probably benign	Het
Arntl2	T	G	6: 146,829,718	V507G	probably benign	Het
Atg9a	T	C	1: 75,184,499	Y701C	probably damaging	Het
Baz2b	C	T	2: 59,932,166	R922Q	probably damaging	Het
Bpnt1	G	A	1: 185,341,216		probably benign	Het
Brms1	T	A	19: 5,046,699	C136*	probably null	Het
Ccdc129	T	C	6: 55,872,472		probably benign	Het
Ccdc180	T	A	4: 45,890,900	V24E	probably benign	Het
Cdh17	A	G	4: 11,785,186	Y326C	possibly damaging	Het
Cgn	A	T	3: 94,762,592	D1080E	possibly damaging	Het
Clec4f	C	T	6: 83,652,929	V216M	probably benign	Het
Cpd	C	G	11: 76,790,838	G1160R	probably damaging	Het
Csf2ra	A	G	19: 61,226,597	L143P	probably damaging	Het
Ddb2	G	T	2: 91,234,820	Q87K	probably benign	Het
Defb41	A	G	1: 18,251,247	Y48H	probably damaging	Het
Dido1	T	C	2: 180,661,474	N1546D	probably benign	Het
Dll1	A	T	17: 15,368,954	H486Q	probably damaging	Het
Dmac1	A	G	4: 75,278,100	V51A	possibly damaging	Het
Dnajb11	C	T	16: 22,862,619	A49V	probably damaging	Het
Dnajc14	G	A	10: 128,807,579	D457N	probably damaging	Het
Eif3a	C	A	19: 60,766,826	D973Y	unknown	Het
Entpd3	T	A	9: 120,557,542	N196K	probably damaging	Het
Fam53a	C	A	5: 33,607,732	G210V	probably damaging	Het
Farsb	T	A	1: 78,462,374	K395*	probably null	Het
Fem1b	A	G	9: 62,796,800	S393P	probably damaging	Het
Fsip2	T	A	2: 82,976,608	D1090E	probably damaging	Het
Fsip2	A	C	2: 82,986,955	N4344T	possibly damaging	Het
Gata3	G	A	2: 9,858,447	P419S	probably damaging	Het
Gm13023	T	A	4: 143,795,002	L396H	probably damaging	Het
Gm7247	T	A	14: 51,569,600		probably benign	Het
Gphn	A	G	12: 78,637,503	S558G	probably damaging	Het
Gpr142	C	A	11: 114,798,929	H2Q	probably benign	Het
Grhpr	T	C	4: 44,988,915		probably benign	Het
Grik3	C	A	4: 125,623,575	N70K	probably damaging	Het
Gsap	T	A	5: 21,250,935		probably benign	Het
Iars	T	A	13: 49,693,135	C237S	probably damaging	Het
Kank2	G	A	9: 21,774,674	R635*	probably null	Het
Kcnj16	G	T	11: 111,024,723	W70C	probably damaging	Het
Kpna6	T	C	4: 129,657,458	M85V	probably benign	Het
Kri1	G	A	9: 21,275,365	S447L	probably damaging	Het
L2hgdh	G	A	12: 69,721,331	P131L	possibly damaging	Het
Lrp1b	A	G	2: 40,742,817	V3528A	probably benign	Het
Lrrc46	A	T	11: 97,038,779	L77Q	probably damaging	Het
Mdc1	A	G	17: 35,849,033	T678A	probably benign	Het
Mrpl44	T	C	1: 79,779,495	L219S	probably damaging	Het
Myo7a	T	C	7: 98,065,698	D112G	probably damaging	Het
Ncoa3	A	G	2: 166,055,178	T630A	possibly damaging	Het
Nsl1	T	C	1: 191,082,184	L194P	probably damaging	Het
Olfr1037	T	C	2: 86,085,361	K139E	probably benign	Het
Olfr205	T	C	16: 59,329,065	Y148C	possibly damaging	Het
Pde4d	A	G	13: 109,740,421	S159G	probably benign	Het
Pi4ka	T	C	16: 17,325,114	R845G	probably null	Het
Pld1	A	G	3: 28,095,884		probably benign	Het
Psd	T	A	19: 46,323,342	I300F	probably damaging	Het
Ptprz1	T	A	6: 22,986,196	W332R	probably damaging	Het
Rab3d	A	T	9: 21,915,926	S3T	possibly damaging	Het
Rnf212	T	A	5: 108,745,664	M70L	possibly damaging	Het
Scd3	A	G	19: 44,215,637	Y88C	probably damaging	Het
Sema4f	A	G	6: 82,919,693		probably benign	Het
Sez6	C	A	11: 77,953,873	T7K	possibly damaging	Het
Skint2	T	C	4: 112,645,463	I290T	probably benign	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Slc4a4	A	C	5: 89,156,336	H502P	possibly damaging	Het
Slc5a3	T	A	16: 92,077,634	I193N	probably damaging	Het
Slc5a4a	A	G	10: 76,178,197	I413V	probably null	Het
Snip1	T	A	4: 125,072,840	Y354*	probably null	Het
Spata31d1c	A	G	13: 65,033,062		probably benign	Het
Speer2	G	A	16: 69,858,752	T62M	probably damaging	Het
Tmco5	A	G	2: 116,887,287	Y200C	probably damaging	Het
Tmem87b	T	A	2: 128,831,441		probably benign	Het
Trim43c	A	T	9: 88,847,515	K336N	probably damaging	Het
Trim60	T	C	8: 65,001,321	E92G	probably benign	Het
Ttc21a	C	A	9: 119,943,940	Q228K	probably damaging	Het
Ttn	A	T	2: 76,796,460	D13067E	possibly damaging	Het
Ufl1	A	T	4: 25,269,087	I168N	probably damaging	Het
Vmn1r167	T	G	7: 23,504,909	R227S	possibly damaging	Het
Vmn2r25	T	A	6: 123,853,025	I56L	probably benign	Het
Zfp385c	G	A	11: 100,629,956	P293S	probably benign	Het
Zfp473	T	A	7: 44,734,475	S144C	probably damaging	Het

Other mutations in Olfr1285

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01328:Olfr1285	APN	2	111409219	missense	probably damaging	1.00
IGL01819:Olfr1285	APN	2	111408733	missense	probably damaging	0.99
IGL02109:Olfr1285	APN	2	111408493	exon	noncoding transcript
IGL02407:Olfr1285	APN	2	111408578	exon	noncoding transcript
R1665:Olfr1285	UTSW	2	111408753	missense	probably damaging	1.00
R2339:Olfr1285	UTSW	2	111409189	missense	probably benign	0.36
R3876:Olfr1285	UTSW	2	111408622	missense	possibly damaging	0.57
R4260:Olfr1285	UTSW	2	111408505	exon	noncoding transcript
R4439:Olfr1285	UTSW	2	111409308	exon	noncoding transcript
R4762:Olfr1285	UTSW	2	111408880	exon	noncoding transcript
R4821:Olfr1285	UTSW	2	111409225	exon	noncoding transcript
R5120:Olfr1285	UTSW	2	111409240	exon	noncoding transcript
R5215:Olfr1285	UTSW	2	111409286	exon	noncoding transcript
R5244:Olfr1285	UTSW	2	111408554	exon	noncoding transcript
R5667:Olfr1285	UTSW	2	111408473	exon	noncoding transcript
R5671:Olfr1285	UTSW	2	111408473	exon	noncoding transcript
R5687:Olfr1285	UTSW	2	111408688	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- AGGGACTGTGTACCTCAAGGCAAC -3'
(R):5'- AGCAAGAAACTTGTCCACCCAAGTG -3'

Sequencing Primer
(F):5'- TCTGATGACTTTGGTAGATAACCTC -3'
(R):5'- CCCAGAGTATCAGTATTCATGCAGG -3'

Posted On

2013-05-23