Incidental Mutation 'R0054:Cgn'
ID 40968
Institutional Source Beutler Lab
Gene Symbol Cgn
Ensembl Gene ENSMUSG00000068876
Gene Name cingulin
Synonyms 6330408J11Rik
MMRRC Submission 038348-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0054 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 94667376-94693826 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 94669899 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1080 (D1080E)
Ref Sequence ENSEMBL: ENSMUSP00000102894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107272] [ENSMUST00000107273]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000107272
AA Change: D1072E

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102893
Gene: ENSMUSG00000068876
AA Change: D1072E

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
low complexity region 189 198 N/A INTRINSIC
internal_repeat_1 214 229 8.06e-5 PROSPERO
low complexity region 242 260 N/A INTRINSIC
internal_repeat_1 287 302 8.06e-5 PROSPERO
low complexity region 446 462 N/A INTRINSIC
low complexity region 466 481 N/A INTRINSIC
low complexity region 536 549 N/A INTRINSIC
low complexity region 567 592 N/A INTRINSIC
low complexity region 660 676 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
Pfam:Myosin_tail_1 783 1140 3.4e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107273
AA Change: D1080E

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102894
Gene: ENSMUSG00000068876
AA Change: D1080E

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
low complexity region 189 198 N/A INTRINSIC
internal_repeat_1 214 229 8.83e-5 PROSPERO
low complexity region 242 260 N/A INTRINSIC
internal_repeat_1 287 302 8.83e-5 PROSPERO
low complexity region 454 470 N/A INTRINSIC
low complexity region 474 489 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 575 600 N/A INTRINSIC
low complexity region 668 684 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
Pfam:Myosin_tail_1 799 1144 2.2e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118050
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (83/84)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased sensitivity to the ulcerogenic action of cysteamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,547,500 (GRCm39) probably null Het
Ahnak T A 19: 8,989,420 (GRCm39) V3568E probably damaging Het
Alpi T C 1: 87,027,487 (GRCm39) E293G possibly damaging Het
Apoa4 A G 9: 46,153,822 (GRCm39) D141G probably benign Het
Atg9a T C 1: 75,161,143 (GRCm39) Y701C probably damaging Het
Baz2b C T 2: 59,762,510 (GRCm39) R922Q probably damaging Het
Bmal2 T G 6: 146,731,216 (GRCm39) V507G probably benign Het
Bpnt1 G A 1: 185,073,413 (GRCm39) probably benign Het
Brms1 T A 19: 5,096,727 (GRCm39) C136* probably null Het
Ccdc180 T A 4: 45,890,900 (GRCm39) V24E probably benign Het
Cdh17 A G 4: 11,785,186 (GRCm39) Y326C possibly damaging Het
Clec4f C T 6: 83,629,911 (GRCm39) V216M probably benign Het
Cpd C G 11: 76,681,664 (GRCm39) G1160R probably damaging Het
Csf2ra A G 19: 61,215,035 (GRCm39) L143P probably damaging Het
Ddb2 G T 2: 91,065,165 (GRCm39) Q87K probably benign Het
Defb41 A G 1: 18,321,471 (GRCm39) Y48H probably damaging Het
Dido1 T C 2: 180,303,267 (GRCm39) N1546D probably benign Het
Dll1 A T 17: 15,589,216 (GRCm39) H486Q probably damaging Het
Dmac1 A G 4: 75,196,337 (GRCm39) V51A possibly damaging Het
Dnajb11 C T 16: 22,681,369 (GRCm39) A49V probably damaging Het
Dnajc14 G A 10: 128,643,448 (GRCm39) D457N probably damaging Het
Eif3a C A 19: 60,755,264 (GRCm39) D973Y unknown Het
Entpd3 T A 9: 120,386,608 (GRCm39) N196K probably damaging Het
Fam53a C A 5: 33,765,076 (GRCm39) G210V probably damaging Het
Farsb T A 1: 78,439,011 (GRCm39) K395* probably null Het
Fem1b A G 9: 62,704,082 (GRCm39) S393P probably damaging Het
Fsip2 T A 2: 82,806,952 (GRCm39) D1090E probably damaging Het
Fsip2 A C 2: 82,817,299 (GRCm39) N4344T possibly damaging Het
Gata3 G A 2: 9,863,258 (GRCm39) P419S probably damaging Het
Gm7247 T A 14: 51,807,057 (GRCm39) probably benign Het
Gphn A G 12: 78,684,277 (GRCm39) S558G probably damaging Het
Gpr142 C A 11: 114,689,755 (GRCm39) H2Q probably benign Het
Grhpr T C 4: 44,988,915 (GRCm39) probably benign Het
Grik3 C A 4: 125,517,368 (GRCm39) N70K probably damaging Het
Gsap T A 5: 21,455,933 (GRCm39) probably benign Het
Iars1 T A 13: 49,846,611 (GRCm39) C237S probably damaging Het
Itprid1 T C 6: 55,849,457 (GRCm39) probably benign Het
Kank2 G A 9: 21,685,970 (GRCm39) R635* probably null Het
Kcnj16 G T 11: 110,915,549 (GRCm39) W70C probably damaging Het
Kpna6 T C 4: 129,551,251 (GRCm39) M85V probably benign Het
Kri1 G A 9: 21,186,661 (GRCm39) S447L probably damaging Het
L2hgdh G A 12: 69,768,105 (GRCm39) P131L possibly damaging Het
Lrp1b A G 2: 40,632,829 (GRCm39) V3528A probably benign Het
Lrrc46 A T 11: 96,929,605 (GRCm39) L77Q probably damaging Het
Mdc1 A G 17: 36,159,925 (GRCm39) T678A probably benign Het
Mrpl44 T C 1: 79,757,212 (GRCm39) L219S probably damaging Het
Myo7a T C 7: 97,714,905 (GRCm39) D112G probably damaging Het
Ncoa3 A G 2: 165,897,098 (GRCm39) T630A possibly damaging Het
Nsl1 T C 1: 190,814,381 (GRCm39) L194P probably damaging Het
Or4k39 G A 2: 111,239,140 (GRCm39) G127S probably benign Het
Or5ac23 T C 16: 59,149,428 (GRCm39) Y148C possibly damaging Het
Or8u10 T C 2: 85,915,705 (GRCm39) K139E probably benign Het
Pde4d A G 13: 109,876,955 (GRCm39) S159G probably benign Het
Pi4ka T C 16: 17,142,978 (GRCm39) R845G probably null Het
Pld1 A G 3: 28,150,033 (GRCm39) probably benign Het
Pramel25 T A 4: 143,521,572 (GRCm39) L396H probably damaging Het
Psd T A 19: 46,311,781 (GRCm39) I300F probably damaging Het
Ptprz1 T A 6: 22,986,195 (GRCm39) W332R probably damaging Het
Rab3d A T 9: 21,827,222 (GRCm39) S3T possibly damaging Het
Rnf212 T A 5: 108,893,530 (GRCm39) M70L possibly damaging Het
Scd3 A G 19: 44,204,076 (GRCm39) Y88C probably damaging Het
Sema4f A G 6: 82,896,674 (GRCm39) probably benign Het
Sez6 C A 11: 77,844,699 (GRCm39) T7K possibly damaging Het
Skint2 T C 4: 112,502,660 (GRCm39) I290T probably benign Het
Slc17a3 C T 13: 24,039,841 (GRCm39) S293F probably damaging Het
Slc35e1 T C 8: 73,246,415 (GRCm39) probably benign Het
Slc4a4 A C 5: 89,304,195 (GRCm39) H502P possibly damaging Het
Slc5a3 T A 16: 91,874,522 (GRCm39) I193N probably damaging Het
Slc5a4a A G 10: 76,014,031 (GRCm39) I413V probably null Het
Snip1 T A 4: 124,966,633 (GRCm39) Y354* probably null Het
Spata31d1c A G 13: 65,180,876 (GRCm39) probably benign Het
Speer2 G A 16: 69,655,640 (GRCm39) T62M probably damaging Het
Tmco5 A G 2: 116,717,768 (GRCm39) Y200C probably damaging Het
Tmem87b T A 2: 128,673,361 (GRCm39) probably benign Het
Trim43c A T 9: 88,729,568 (GRCm39) K336N probably damaging Het
Trim60 T C 8: 65,453,973 (GRCm39) E92G probably benign Het
Ttc21a C A 9: 119,773,006 (GRCm39) Q228K probably damaging Het
Ttn A T 2: 76,626,804 (GRCm39) D13067E possibly damaging Het
Ufl1 A T 4: 25,269,087 (GRCm39) I168N probably damaging Het
Vmn1r167 T G 7: 23,204,334 (GRCm39) R227S possibly damaging Het
Vmn2r25 T A 6: 123,829,984 (GRCm39) I56L probably benign Het
Zfp385c G A 11: 100,520,782 (GRCm39) P293S probably benign Het
Zfp473 T A 7: 44,383,899 (GRCm39) S144C probably damaging Het
Other mutations in Cgn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Cgn APN 3 94,672,855 (GRCm39) missense probably benign 0.00
IGL00823:Cgn APN 3 94,674,519 (GRCm39) missense probably damaging 1.00
IGL01349:Cgn APN 3 94,674,486 (GRCm39) nonsense probably null
IGL01433:Cgn APN 3 94,686,769 (GRCm39) missense probably damaging 0.99
IGL01467:Cgn APN 3 94,686,898 (GRCm39) missense probably damaging 1.00
IGL01781:Cgn APN 3 94,680,515 (GRCm39) missense probably benign
IGL01789:Cgn APN 3 94,683,528 (GRCm39) missense possibly damaging 0.63
IGL01879:Cgn APN 3 94,681,674 (GRCm39) nonsense probably null
IGL02805:Cgn APN 3 94,681,687 (GRCm39) missense probably damaging 0.96
IGL02814:Cgn APN 3 94,681,550 (GRCm39) missense probably benign 0.00
IGL02926:Cgn APN 3 94,685,326 (GRCm39) missense probably benign 0.01
IGL03113:Cgn APN 3 94,686,544 (GRCm39) missense probably benign
IGL03340:Cgn APN 3 94,685,405 (GRCm39) intron probably benign
R0310:Cgn UTSW 3 94,672,960 (GRCm39) missense possibly damaging 0.88
R0355:Cgn UTSW 3 94,682,242 (GRCm39) missense probably benign
R0615:Cgn UTSW 3 94,678,024 (GRCm39) unclassified probably benign
R0656:Cgn UTSW 3 94,682,204 (GRCm39) unclassified probably benign
R1491:Cgn UTSW 3 94,670,535 (GRCm39) missense probably damaging 1.00
R1509:Cgn UTSW 3 94,681,568 (GRCm39) missense probably benign 0.00
R1794:Cgn UTSW 3 94,669,864 (GRCm39) critical splice donor site probably null
R2113:Cgn UTSW 3 94,687,116 (GRCm39) missense probably damaging 1.00
R3121:Cgn UTSW 3 94,685,792 (GRCm39) splice site probably benign
R4655:Cgn UTSW 3 94,686,559 (GRCm39) nonsense probably null
R4703:Cgn UTSW 3 94,683,405 (GRCm39) utr 3 prime probably benign
R4714:Cgn UTSW 3 94,686,748 (GRCm39) missense probably damaging 1.00
R4715:Cgn UTSW 3 94,686,748 (GRCm39) missense probably damaging 1.00
R4959:Cgn UTSW 3 94,685,564 (GRCm39) missense probably benign 0.06
R4973:Cgn UTSW 3 94,685,564 (GRCm39) missense probably benign 0.06
R4995:Cgn UTSW 3 94,687,246 (GRCm39) missense probably damaging 1.00
R5011:Cgn UTSW 3 94,683,455 (GRCm39) missense probably null 1.00
R5329:Cgn UTSW 3 94,687,300 (GRCm39) start codon destroyed probably null 0.02
R5524:Cgn UTSW 3 94,687,299 (GRCm39) start codon destroyed probably null 0.56
R5695:Cgn UTSW 3 94,680,945 (GRCm39) missense probably benign 0.00
R5839:Cgn UTSW 3 94,681,703 (GRCm39) missense probably damaging 0.99
R5987:Cgn UTSW 3 94,686,832 (GRCm39) missense probably benign 0.00
R6146:Cgn UTSW 3 94,674,435 (GRCm39) missense possibly damaging 0.94
R6311:Cgn UTSW 3 94,685,486 (GRCm39) intron probably benign
R6948:Cgn UTSW 3 94,680,531 (GRCm39) missense probably benign 0.06
R7038:Cgn UTSW 3 94,670,392 (GRCm39) missense possibly damaging 0.80
R7231:Cgn UTSW 3 94,680,502 (GRCm39) missense probably damaging 0.99
R7251:Cgn UTSW 3 94,683,509 (GRCm39) missense possibly damaging 0.82
R7408:Cgn UTSW 3 94,670,362 (GRCm39) nonsense probably null
R7828:Cgn UTSW 3 94,676,489 (GRCm39) missense probably damaging 0.97
R7882:Cgn UTSW 3 94,669,941 (GRCm39) missense probably damaging 1.00
R7975:Cgn UTSW 3 94,671,836 (GRCm39) missense probably benign 0.03
R8082:Cgn UTSW 3 94,670,368 (GRCm39) missense probably benign 0.21
R8090:Cgn UTSW 3 94,687,263 (GRCm39) missense probably damaging 1.00
R8128:Cgn UTSW 3 94,676,691 (GRCm39) missense probably benign 0.06
R8275:Cgn UTSW 3 94,682,263 (GRCm39) missense possibly damaging 0.52
R8774:Cgn UTSW 3 94,680,810 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Cgn UTSW 3 94,680,810 (GRCm39) missense probably damaging 1.00
R9036:Cgn UTSW 3 94,674,551 (GRCm39) missense possibly damaging 0.90
R9060:Cgn UTSW 3 94,687,165 (GRCm39) missense probably damaging 1.00
R9434:Cgn UTSW 3 94,672,837 (GRCm39) missense probably damaging 0.99
R9616:Cgn UTSW 3 94,670,332 (GRCm39) missense probably damaging 0.97
R9720:Cgn UTSW 3 94,686,621 (GRCm39) missense probably benign 0.10
Z1176:Cgn UTSW 3 94,683,488 (GRCm39) missense probably benign 0.16
Z1176:Cgn UTSW 3 94,681,656 (GRCm39) missense probably damaging 1.00
Z1176:Cgn UTSW 3 94,681,583 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ATGGGACCTCCCTTGCAATGACTC -3'
(R):5'- ATCTACTGGTGACGCTCAGGACAG -3'

Sequencing Primer
(F):5'- aagcatagaatctaagttcaatctcc -3'
(R):5'- TGACGCTCAGGACAGAGATG -3'
Posted On 2013-05-23