Incidental Mutation 'R0054:Cdh17'
ID40969
Institutional Source Beutler Lab
Gene Symbol Cdh17
Ensembl Gene ENSMUSG00000028217
Gene Namecadherin 17
SynonymsBILL-cadherin, LI-cadherin, HPT-1
MMRRC Submission 038348-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R0054 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location11758147-11817895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11785186 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 326 (Y326C)
Ref Sequence ENSEMBL: ENSMUSP00000103938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029871] [ENSMUST00000108303]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029871
AA Change: Y326C

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029871
Gene: ENSMUSG00000028217
AA Change: Y326C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 44 123 5.27e-10 SMART
CA 147 241 6.9e-14 SMART
CA 258 337 3.05e-15 SMART
CA 361 446 3.29e-11 SMART
CA 471 564 5.27e-10 SMART
CA 587 664 5.59e-23 SMART
Blast:CA 687 771 5e-39 BLAST
transmembrane domain 784 806 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108303
AA Change: Y326C

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103938
Gene: ENSMUSG00000028217
AA Change: Y326C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 44 123 5.27e-10 SMART
CA 147 241 6.9e-14 SMART
CA 258 337 3.05e-15 SMART
CA 361 446 3.29e-11 SMART
CA 471 564 5.27e-10 SMART
CA 587 664 5.59e-23 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. The encoded protein is cadherin-like, consisting of an extracellular region, containing 7 cadherin domains, and a transmembrane region but lacking the conserved cytoplasmic domain. The protein is a component of the gastrointestinal tract and pancreatic ducts, acting as an intestinal proton-dependent peptide transporter in the first step in oral absorption of many medically important peptide-based drugs. The protein may also play a role in the morphological organization of liver and intestine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mutant mice exhibit impaired B lymphocyte development and impaired IgG1 and IgG3 antibody response to T-independent antigen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,601,774 probably null Het
Ahnak T A 19: 9,012,056 V3568E probably damaging Het
Alpi T C 1: 87,099,765 E293G possibly damaging Het
Apoa4 A G 9: 46,242,524 D141G probably benign Het
Arntl2 T G 6: 146,829,718 V507G probably benign Het
Atg9a T C 1: 75,184,499 Y701C probably damaging Het
Baz2b C T 2: 59,932,166 R922Q probably damaging Het
Bpnt1 G A 1: 185,341,216 probably benign Het
Brms1 T A 19: 5,046,699 C136* probably null Het
Ccdc129 T C 6: 55,872,472 probably benign Het
Ccdc180 T A 4: 45,890,900 V24E probably benign Het
Cgn A T 3: 94,762,592 D1080E possibly damaging Het
Clec4f C T 6: 83,652,929 V216M probably benign Het
Cpd C G 11: 76,790,838 G1160R probably damaging Het
Csf2ra A G 19: 61,226,597 L143P probably damaging Het
Ddb2 G T 2: 91,234,820 Q87K probably benign Het
Defb41 A G 1: 18,251,247 Y48H probably damaging Het
Dido1 T C 2: 180,661,474 N1546D probably benign Het
Dll1 A T 17: 15,368,954 H486Q probably damaging Het
Dmac1 A G 4: 75,278,100 V51A possibly damaging Het
Dnajb11 C T 16: 22,862,619 A49V probably damaging Het
Dnajc14 G A 10: 128,807,579 D457N probably damaging Het
Eif3a C A 19: 60,766,826 D973Y unknown Het
Entpd3 T A 9: 120,557,542 N196K probably damaging Het
Fam53a C A 5: 33,607,732 G210V probably damaging Het
Farsb T A 1: 78,462,374 K395* probably null Het
Fem1b A G 9: 62,796,800 S393P probably damaging Het
Fsip2 T A 2: 82,976,608 D1090E probably damaging Het
Fsip2 A C 2: 82,986,955 N4344T possibly damaging Het
Gata3 G A 2: 9,858,447 P419S probably damaging Het
Gm13023 T A 4: 143,795,002 L396H probably damaging Het
Gm7247 T A 14: 51,569,600 probably benign Het
Gphn A G 12: 78,637,503 S558G probably damaging Het
Gpr142 C A 11: 114,798,929 H2Q probably benign Het
Grhpr T C 4: 44,988,915 probably benign Het
Grik3 C A 4: 125,623,575 N70K probably damaging Het
Gsap T A 5: 21,250,935 probably benign Het
Iars T A 13: 49,693,135 C237S probably damaging Het
Kank2 G A 9: 21,774,674 R635* probably null Het
Kcnj16 G T 11: 111,024,723 W70C probably damaging Het
Kpna6 T C 4: 129,657,458 M85V probably benign Het
Kri1 G A 9: 21,275,365 S447L probably damaging Het
L2hgdh G A 12: 69,721,331 P131L possibly damaging Het
Lrp1b A G 2: 40,742,817 V3528A probably benign Het
Lrrc46 A T 11: 97,038,779 L77Q probably damaging Het
Mdc1 A G 17: 35,849,033 T678A probably benign Het
Mrpl44 T C 1: 79,779,495 L219S probably damaging Het
Myo7a T C 7: 98,065,698 D112G probably damaging Het
Ncoa3 A G 2: 166,055,178 T630A possibly damaging Het
Nsl1 T C 1: 191,082,184 L194P probably damaging Het
Olfr1037 T C 2: 86,085,361 K139E probably benign Het
Olfr1285 G A 2: 111,408,795 G127S probably benign Het
Olfr205 T C 16: 59,329,065 Y148C possibly damaging Het
Pde4d A G 13: 109,740,421 S159G probably benign Het
Pi4ka T C 16: 17,325,114 R845G probably null Het
Pld1 A G 3: 28,095,884 probably benign Het
Psd T A 19: 46,323,342 I300F probably damaging Het
Ptprz1 T A 6: 22,986,196 W332R probably damaging Het
Rab3d A T 9: 21,915,926 S3T possibly damaging Het
Rnf212 T A 5: 108,745,664 M70L possibly damaging Het
Scd3 A G 19: 44,215,637 Y88C probably damaging Het
Sema4f A G 6: 82,919,693 probably benign Het
Sez6 C A 11: 77,953,873 T7K possibly damaging Het
Skint2 T C 4: 112,645,463 I290T probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc5a3 T A 16: 92,077,634 I193N probably damaging Het
Slc5a4a A G 10: 76,178,197 I413V probably null Het
Snip1 T A 4: 125,072,840 Y354* probably null Het
Spata31d1c A G 13: 65,033,062 probably benign Het
Speer2 G A 16: 69,858,752 T62M probably damaging Het
Tmco5 A G 2: 116,887,287 Y200C probably damaging Het
Tmem87b T A 2: 128,831,441 probably benign Het
Trim43c A T 9: 88,847,515 K336N probably damaging Het
Trim60 T C 8: 65,001,321 E92G probably benign Het
Ttc21a C A 9: 119,943,940 Q228K probably damaging Het
Ttn A T 2: 76,796,460 D13067E possibly damaging Het
Ufl1 A T 4: 25,269,087 I168N probably damaging Het
Vmn1r167 T G 7: 23,504,909 R227S possibly damaging Het
Vmn2r25 T A 6: 123,853,025 I56L probably benign Het
Zfp385c G A 11: 100,629,956 P293S probably benign Het
Zfp473 T A 7: 44,734,475 S144C probably damaging Het
Other mutations in Cdh17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Cdh17 APN 4 11797780 splice site probably benign
IGL00823:Cdh17 APN 4 11783412 missense possibly damaging 0.78
IGL00824:Cdh17 APN 4 11784675 missense probably benign 0.00
IGL01572:Cdh17 APN 4 11784621 splice site probably benign
IGL01602:Cdh17 APN 4 11795670 missense probably damaging 1.00
IGL01605:Cdh17 APN 4 11795670 missense probably damaging 1.00
IGL01759:Cdh17 APN 4 11771262 splice site probably benign
IGL02065:Cdh17 APN 4 11771373 splice site probably benign
IGL02448:Cdh17 APN 4 11784680 missense probably benign
IGL02869:Cdh17 APN 4 11814908 missense probably benign 0.00
IGL03088:Cdh17 APN 4 11810473 missense probably damaging 1.00
Disruptive UTSW 4 11784654 missense probably damaging 1.00
R0081:Cdh17 UTSW 4 11785280 splice site probably benign
R0101:Cdh17 UTSW 4 11771341 missense probably benign 0.00
R0432:Cdh17 UTSW 4 11771273 nonsense probably null
R0718:Cdh17 UTSW 4 11810451 missense possibly damaging 0.68
R0946:Cdh17 UTSW 4 11795581 missense probably benign 0.01
R1076:Cdh17 UTSW 4 11795581 missense probably benign 0.01
R1217:Cdh17 UTSW 4 11799676 missense probably benign 0.04
R2060:Cdh17 UTSW 4 11803982 missense probably benign 0.03
R3808:Cdh17 UTSW 4 11795671 missense probably damaging 0.99
R3850:Cdh17 UTSW 4 11785201 missense probably damaging 1.00
R4111:Cdh17 UTSW 4 11814628 missense probably damaging 0.99
R4112:Cdh17 UTSW 4 11814628 missense probably damaging 0.99
R4583:Cdh17 UTSW 4 11810466 missense probably benign 0.00
R4683:Cdh17 UTSW 4 11817036 missense possibly damaging 0.78
R4797:Cdh17 UTSW 4 11810390 missense probably benign 0.00
R5050:Cdh17 UTSW 4 11784654 missense probably damaging 1.00
R5071:Cdh17 UTSW 4 11810325 missense probably damaging 0.98
R5569:Cdh17 UTSW 4 11816990 missense probably damaging 0.96
R5790:Cdh17 UTSW 4 11814945 unclassified probably null
R6077:Cdh17 UTSW 4 11803969 missense probably benign 0.22
R6581:Cdh17 UTSW 4 11799615 missense probably damaging 1.00
R7274:Cdh17 UTSW 4 11783174 nonsense probably null
R7647:Cdh17 UTSW 4 11814698 missense probably damaging 1.00
R7649:Cdh17 UTSW 4 11814698 missense probably damaging 1.00
X0067:Cdh17 UTSW 4 11785224 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAACAAGGAGAAGCTGTCGCC -3'
(R):5'- GCTCTGTGACAAGGACAATGGACTG -3'

Sequencing Primer
(F):5'- CTGTGGGATGATGAAATTCACTCC -3'
(R):5'- AGGAAGGCAGGTTCATGACATC -3'
Posted On2013-05-23