Incidental Mutation 'R0054:Gphn'
ID41011
Institutional Source Beutler Lab
Gene Symbol Gphn
Ensembl Gene ENSMUSG00000047454
Gene Namegephyrin
Synonyms5730552E08Rik, geph
MMRRC Submission 038348-MU
Accession Numbers

Genbank: NM_145965, NM_172952; MGI: 109602

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0054 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location78226379-78684772 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78637503 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 558 (S558G)
Ref Sequence ENSEMBL: ENSMUSP00000054064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052472] [ENSMUST00000110388]
Predicted Effect probably damaging
Transcript: ENSMUST00000052472
AA Change: S558G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054064
Gene: ENSMUSG00000047454
AA Change: S558G

DomainStartEndE-ValueType
MoCF_biosynth 18 165 4.52e-27 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:MoeA_N 356 522 5.6e-53 PFAM
MoCF_biosynth 535 678 8.1e-38 SMART
Pfam:MoeA_C 691 766 8.9e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110388
AA Change: S561G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106018
Gene: ENSMUSG00000047454
AA Change: S561G

DomainStartEndE-ValueType
MoCF_biosynth 18 165 4.52e-27 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:MoeA_N 360 525 2.1e-35 PFAM
MoCF_biosynth 538 681 8.1e-38 SMART
Pfam:MoeA_C 694 769 8.1e-26 PFAM
Meta Mutation Damage Score 0.6833 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a neuronal assembly protein that anchors inhibitory neurotransmitter receptors to the postsynaptic cytoskeleton via high affinity binding to a receptor subunit domain and tubulin dimers. In nonneuronal tissues, the encoded protein is also required for molybdenum cofactor biosynthesis. Mutations in this gene may be associated with the neurological condition hyperplexia and also lead to molybdenum cofactor deficiency. Numerous alternatively spliced transcript variants encoding different isoforms have been described; however, the full-length nature of all transcript variants is not currently known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die within one day of birth, apparently due to an inability to suckle. Apnea also develops within 12 hours of birth. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, knock-out(1) Gene trapped(10)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,601,774 probably null Het
Ahnak T A 19: 9,012,056 V3568E probably damaging Het
Alpi T C 1: 87,099,765 E293G possibly damaging Het
Apoa4 A G 9: 46,242,524 D141G probably benign Het
Arntl2 T G 6: 146,829,718 V507G probably benign Het
Atg9a T C 1: 75,184,499 Y701C probably damaging Het
Baz2b C T 2: 59,932,166 R922Q probably damaging Het
Bpnt1 G A 1: 185,341,216 probably benign Het
Brms1 T A 19: 5,046,699 C136* probably null Het
Ccdc129 T C 6: 55,872,472 probably benign Het
Ccdc180 T A 4: 45,890,900 V24E probably benign Het
Cdh17 A G 4: 11,785,186 Y326C possibly damaging Het
Cgn A T 3: 94,762,592 D1080E possibly damaging Het
Clec4f C T 6: 83,652,929 V216M probably benign Het
Cpd C G 11: 76,790,838 G1160R probably damaging Het
Csf2ra A G 19: 61,226,597 L143P probably damaging Het
Ddb2 G T 2: 91,234,820 Q87K probably benign Het
Defb41 A G 1: 18,251,247 Y48H probably damaging Het
Dido1 T C 2: 180,661,474 N1546D probably benign Het
Dll1 A T 17: 15,368,954 H486Q probably damaging Het
Dmac1 A G 4: 75,278,100 V51A possibly damaging Het
Dnajb11 C T 16: 22,862,619 A49V probably damaging Het
Dnajc14 G A 10: 128,807,579 D457N probably damaging Het
Eif3a C A 19: 60,766,826 D973Y unknown Het
Entpd3 T A 9: 120,557,542 N196K probably damaging Het
Fam53a C A 5: 33,607,732 G210V probably damaging Het
Farsb T A 1: 78,462,374 K395* probably null Het
Fem1b A G 9: 62,796,800 S393P probably damaging Het
Fsip2 T A 2: 82,976,608 D1090E probably damaging Het
Fsip2 A C 2: 82,986,955 N4344T possibly damaging Het
Gata3 G A 2: 9,858,447 P419S probably damaging Het
Gm13023 T A 4: 143,795,002 L396H probably damaging Het
Gm7247 T A 14: 51,569,600 probably benign Het
Gpr142 C A 11: 114,798,929 H2Q probably benign Het
Grhpr T C 4: 44,988,915 probably benign Het
Grik3 C A 4: 125,623,575 N70K probably damaging Het
Gsap T A 5: 21,250,935 probably benign Het
Iars T A 13: 49,693,135 C237S probably damaging Het
Kank2 G A 9: 21,774,674 R635* probably null Het
Kcnj16 G T 11: 111,024,723 W70C probably damaging Het
Kpna6 T C 4: 129,657,458 M85V probably benign Het
Kri1 G A 9: 21,275,365 S447L probably damaging Het
L2hgdh G A 12: 69,721,331 P131L possibly damaging Het
Lrp1b A G 2: 40,742,817 V3528A probably benign Het
Lrrc46 A T 11: 97,038,779 L77Q probably damaging Het
Mdc1 A G 17: 35,849,033 T678A probably benign Het
Mrpl44 T C 1: 79,779,495 L219S probably damaging Het
Myo7a T C 7: 98,065,698 D112G probably damaging Het
Ncoa3 A G 2: 166,055,178 T630A possibly damaging Het
Nsl1 T C 1: 191,082,184 L194P probably damaging Het
Olfr1037 T C 2: 86,085,361 K139E probably benign Het
Olfr1285 G A 2: 111,408,795 G127S probably benign Het
Olfr205 T C 16: 59,329,065 Y148C possibly damaging Het
Pde4d A G 13: 109,740,421 S159G probably benign Het
Pi4ka T C 16: 17,325,114 R845G probably null Het
Pld1 A G 3: 28,095,884 probably benign Het
Psd T A 19: 46,323,342 I300F probably damaging Het
Ptprz1 T A 6: 22,986,196 W332R probably damaging Het
Rab3d A T 9: 21,915,926 S3T possibly damaging Het
Rnf212 T A 5: 108,745,664 M70L possibly damaging Het
Scd3 A G 19: 44,215,637 Y88C probably damaging Het
Sema4f A G 6: 82,919,693 probably benign Het
Sez6 C A 11: 77,953,873 T7K possibly damaging Het
Skint2 T C 4: 112,645,463 I290T probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc5a3 T A 16: 92,077,634 I193N probably damaging Het
Slc5a4a A G 10: 76,178,197 I413V probably null Het
Snip1 T A 4: 125,072,840 Y354* probably null Het
Spata31d1c A G 13: 65,033,062 probably benign Het
Speer2 G A 16: 69,858,752 T62M probably damaging Het
Tmco5 A G 2: 116,887,287 Y200C probably damaging Het
Tmem87b T A 2: 128,831,441 probably benign Het
Trim43c A T 9: 88,847,515 K336N probably damaging Het
Trim60 T C 8: 65,001,321 E92G probably benign Het
Ttc21a C A 9: 119,943,940 Q228K probably damaging Het
Ttn A T 2: 76,796,460 D13067E possibly damaging Het
Ufl1 A T 4: 25,269,087 I168N probably damaging Het
Vmn1r167 T G 7: 23,504,909 R227S possibly damaging Het
Vmn2r25 T A 6: 123,853,025 I56L probably benign Het
Zfp385c G A 11: 100,629,956 P293S probably benign Het
Zfp473 T A 7: 44,734,475 S144C probably damaging Het
Other mutations in Gphn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Gphn APN 12 78504632 missense probably damaging 1.00
IGL00701:Gphn APN 12 78626167 missense possibly damaging 0.93
IGL00844:Gphn APN 12 78664568 splice site probably benign
IGL01517:Gphn APN 12 78376374 missense probably damaging 1.00
IGL02499:Gphn APN 12 78492300 missense probably benign 0.17
IGL02827:Gphn APN 12 78609220 missense probably damaging 1.00
IGL03136:Gphn APN 12 78481333 missense possibly damaging 0.69
IGL03348:Gphn APN 12 78627119 missense probably damaging 0.99
IGL03382:Gphn APN 12 78481313 missense probably damaging 1.00
grizzlies UTSW 12 78654880 missense probably benign 0.28
3-1:Gphn UTSW 12 78613001 missense probably benign 0.06
R0054:Gphn UTSW 12 78637503 missense probably damaging 1.00
R0212:Gphn UTSW 12 78637552 missense probably damaging 0.99
R0389:Gphn UTSW 12 78590659 missense probably damaging 1.00
R0535:Gphn UTSW 12 78492050 missense possibly damaging 0.90
R1464:Gphn UTSW 12 78612964 splice site probably benign
R1503:Gphn UTSW 12 78504629 missense possibly damaging 0.94
R1606:Gphn UTSW 12 78683883 missense probably damaging 1.00
R1896:Gphn UTSW 12 78412354 missense possibly damaging 0.74
R2248:Gphn UTSW 12 78454821 missense probably damaging 1.00
R3708:Gphn UTSW 12 78532693 missense probably benign
R3907:Gphn UTSW 12 78493942 splice site probably benign
R4537:Gphn UTSW 12 78494014 missense probably benign 0.03
R4667:Gphn UTSW 12 78454817 missense probably damaging 1.00
R4808:Gphn UTSW 12 78654880 missense probably benign 0.28
R4840:Gphn UTSW 12 78522955 critical splice donor site probably null
R4852:Gphn UTSW 12 78627210 missense probably damaging 1.00
R4854:Gphn UTSW 12 78627210 missense probably damaging 1.00
R4855:Gphn UTSW 12 78627210 missense probably damaging 1.00
R5083:Gphn UTSW 12 78623289 splice site probably null
R5224:Gphn UTSW 12 78590587 missense probably damaging 0.99
R5580:Gphn UTSW 12 78492044 missense probably damaging 1.00
R5626:Gphn UTSW 12 78683897 missense probably benign 0.11
R6270:Gphn UTSW 12 78522950 missense probably benign
R6563:Gphn UTSW 12 78680396 critical splice donor site probably null
R6943:Gphn UTSW 12 78492181 missense possibly damaging 0.88
R6958:Gphn UTSW 12 78680299 missense possibly damaging 0.86
R7170:Gphn UTSW 12 78683889 missense possibly damaging 0.67
R7295:Gphn UTSW 12 78492102 missense probably benign 0.02
R7514:Gphn UTSW 12 78626165 missense probably damaging 0.97
R7537:Gphn UTSW 12 78504680 missense possibly damaging 0.62
R7680:Gphn UTSW 12 78412374 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AAGCTGGTGTGAAATCTGGCCGAC -3'
(R):5'- GTGAGCAGCAATGGCTTCACTATCC -3'

Sequencing Primer
(F):5'- GAAATCTGGCCGACTGTTCAAC -3'
(R):5'- AGTCGAATGCACCTCTATTTAGGC -3'
Posted On2013-05-23