Incidental Mutation 'R0066:Ubqlnl'
ID41076
Institutional Source Beutler Lab
Gene Symbol Ubqlnl
Ensembl Gene ENSMUSG00000051437
Gene Nameubiquilin-like
SynonymsLOC244179, 4922504M18Rik
MMRRC Submission 038357-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R0066 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104148259-104150556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104148938 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 451 (W451R)
Ref Sequence ENSEMBL: ENSMUSP00000056365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051137] [ENSMUST00000059121]
PDB Structure
Solution Structure of RSGI RUH-056, a UBA domain from mouse cDNA [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000051137
SMART Domains Protein: ENSMUSP00000052174
Gene: ENSMUSG00000044265

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 47 85 N/A INTRINSIC
coiled coil region 157 198 N/A INTRINSIC
OLF 211 468 3.13e-70 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000059121
AA Change: W451R

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056365
Gene: ENSMUSG00000051437
AA Change: W451R

DomainStartEndE-ValueType
UBQ 31 101 5.13e-16 SMART
Blast:STI1 199 237 8e-11 BLAST
low complexity region 339 350 N/A INTRINSIC
low complexity region 402 419 N/A INTRINSIC
PDB:2DNA|A 561 610 3e-26 PDB
Blast:UBA 568 604 1e-10 BLAST
Meta Mutation Damage Score 0.2117 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.0%
Validation Efficiency 100% (107/107)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal in terms of growth and behavior. Adult males are fertile and show no apparent defects in spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik A G 9: 22,207,881 noncoding transcript Het
5530400C23Rik A T 6: 133,292,324 probably benign Het
Aco2 T C 15: 81,903,465 probably benign Het
Arap3 A T 18: 37,996,707 S134T probably benign Het
Arsa T A 15: 89,474,336 M288L possibly damaging Het
Atg2b A T 12: 105,648,449 D1074E probably benign Het
Baiap2l1 A T 5: 144,284,562 I174N probably damaging Het
Bpifb9a A T 2: 154,266,841 N421Y possibly damaging Het
Btn2a2 T A 13: 23,478,485 I432L probably benign Het
Ccdc150 A G 1: 54,356,691 I778V probably benign Het
Cd200r2 G A 16: 44,909,674 V194I possibly damaging Het
Cep350 A C 1: 155,911,218 L1421R probably damaging Het
Col24a1 G A 3: 145,545,144 A1633T probably damaging Het
Col6a6 A T 9: 105,702,213 C1938S probably damaging Het
Cspg4 A T 9: 56,888,134 D1051V probably damaging Het
Cstf1 T A 2: 172,373,056 N32K probably benign Het
Ctrb1 G A 8: 111,686,637 R248* probably null Het
Cyp2d11 T A 15: 82,391,757 M208L probably benign Het
Dbt A G 3: 116,543,829 Q334R probably benign Het
Dcaf12 A G 4: 41,298,338 V270A probably damaging Het
Dis3l T A 9: 64,319,165 N361I probably benign Het
Dnah10 A T 5: 124,763,076 D1315V probably benign Het
Dnah11 A G 12: 118,126,886 F1080S probably benign Het
Dnm3 A G 1: 162,407,361 V70A probably damaging Het
Dpy19l1 A C 9: 24,414,409 M700R possibly damaging Het
Dpy19l2 G A 9: 24,646,383 probably benign Het
Dst C A 1: 34,189,553 H2254N possibly damaging Het
Epm2aip1 A G 9: 111,272,463 N168S probably benign Het
Fchsd2 A G 7: 101,278,424 Y691C possibly damaging Het
Fndc8 A T 11: 82,897,572 D76V probably benign Het
Frmd4a T C 2: 4,473,152 L48P probably damaging Het
Gimap6 T A 6: 48,702,470 I211F probably damaging Het
Gm15130 A G 2: 111,138,939 probably benign Het
Gm43302 T A 5: 105,290,900 I41F probably damaging Het
Gm5698 C T 1: 30,977,533 V146I probably benign Het
Gpatch1 G A 7: 35,287,227 S768L probably damaging Het
Grb14 T G 2: 64,938,492 probably null Het
Hnrnpd T C 5: 99,964,701 E222G probably damaging Het
Il4ra C T 7: 125,576,231 P537L possibly damaging Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kcnh4 T C 11: 100,757,800 H26R probably benign Het
Kctd2 T G 11: 115,429,517 probably benign Het
Khdrbs3 T A 15: 68,995,037 probably benign Het
Macf1 G A 4: 123,432,150 Q3066* probably null Het
Mfn2 G A 4: 147,885,445 probably benign Het
Mmab T C 5: 114,436,465 probably benign Het
Mrc1 T C 2: 14,261,200 S310P probably benign Het
Mrps21 T C 3: 95,862,885 Y44C probably null Het
Myh10 T A 11: 68,699,491 F121Y probably damaging Het
Myo1f A G 17: 33,601,703 D840G probably damaging Het
Neb T A 2: 52,306,530 D553V probably damaging Het
Nol6 G T 4: 41,119,572 probably benign Het
Npr2 G T 4: 43,632,329 V49L probably benign Het
Ntsr2 T C 12: 16,654,119 I207T probably benign Het
Nwd1 T A 8: 72,711,856 S1552T probably benign Het
Oas3 T A 5: 120,758,875 I894F probably damaging Het
Olfr169 T A 16: 19,566,049 Y278F probably damaging Het
Olfr456 A T 6: 42,486,935 M86K probably benign Het
Olfr736 T A 14: 50,393,202 F149I probably benign Het
Olfr983 T C 9: 40,092,687 N93S possibly damaging Het
Oprd1 A G 4: 132,113,988 F220L probably benign Het
Pkd1l3 G T 8: 109,620,471 G159C unknown Het
Plcb4 T C 2: 135,961,769 S521P probably benign Het
Plcl1 A T 1: 55,713,475 I993F probably damaging Het
Plcxd1 T A 5: 110,101,502 V65E probably damaging Het
Plekha7 T C 7: 116,157,508 S640G probably damaging Het
Ptprn2 A C 12: 117,276,602 N993T probably benign Het
Rabepk T C 2: 34,795,306 D26G possibly damaging Het
Reck A G 4: 43,930,936 N646D probably damaging Het
Rfx2 A T 17: 56,786,736 probably benign Het
Ripk2 G A 4: 16,123,868 Q436* probably null Het
Ryr1 C T 7: 29,005,567 probably benign Het
Sema6b A G 17: 56,128,271 V324A possibly damaging Het
Sik2 C A 9: 50,998,533 M73I probably benign Het
Slc39a6 T C 18: 24,599,269 K321E probably damaging Het
Slc7a4 C A 16: 17,574,011 V520F probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spink14 T C 18: 44,028,763 V2A probably benign Het
Sptan1 C A 2: 30,003,667 probably benign Het
Stab1 C T 14: 31,157,070 probably benign Het
Tbc1d17 C T 7: 44,844,071 probably benign Het
Tbcd T A 11: 121,503,764 L49* probably null Het
Tmco6 A G 18: 36,742,107 T477A probably benign Het
Tmem208 C T 8: 105,328,225 A53V probably benign Het
Tpp2 A G 1: 43,981,748 T837A possibly damaging Het
Tulp4 A T 17: 6,201,733 N60I probably damaging Het
Usp53 G T 3: 122,953,307 C363* probably null Het
Usp7 A T 16: 8,691,418 H1017Q probably benign Het
Utp4 A G 8: 106,922,898 T660A possibly damaging Het
Vmn1r194 A T 13: 22,244,471 Y86F probably benign Het
Vmn1r195 A T 13: 22,279,239 H293L possibly damaging Het
Vmn1r231 T C 17: 20,889,736 R306G probably benign Het
Vmn2r63 T C 7: 42,927,090 probably benign Het
Vmn2r77 T C 7: 86,800,756 V70A probably benign Het
Vmn2r85 T C 10: 130,425,901 D189G probably damaging Het
Vps8 A G 16: 21,477,523 E515G possibly damaging Het
Wdr18 C A 10: 79,961,103 Y104* probably null Het
Wnk4 A T 11: 101,265,435 D43V probably damaging Het
Xab2 A T 8: 3,613,880 N346K probably damaging Het
Xirp2 T C 2: 67,512,140 V1575A possibly damaging Het
Zdhhc12 C T 2: 30,092,535 R50H probably damaging Het
Zdhhc8 A G 16: 18,225,200 S379P probably benign Het
Zfp458 G A 13: 67,259,609 Q58* probably null Het
Zfp747 A T 7: 127,374,600 S133T probably benign Het
Other mutations in Ubqlnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Ubqlnl APN 7 104149165 missense probably benign
IGL01592:Ubqlnl APN 7 104150289 unclassified probably benign
IGL01972:Ubqlnl APN 7 104149697 missense probably benign 0.00
IGL02266:Ubqlnl APN 7 104149547 nonsense probably null
IGL02447:Ubqlnl APN 7 104148649 missense probably damaging 1.00
IGL03232:Ubqlnl APN 7 104148629 missense possibly damaging 0.71
FR4737:Ubqlnl UTSW 7 104149835 unclassified probably benign
R0066:Ubqlnl UTSW 7 104148938 missense probably damaging 0.98
R0077:Ubqlnl UTSW 7 104150047 missense probably damaging 1.00
R0109:Ubqlnl UTSW 7 104150192 missense probably damaging 1.00
R0109:Ubqlnl UTSW 7 104150192 missense probably damaging 1.00
R0517:Ubqlnl UTSW 7 104148638 missense probably damaging 1.00
R1129:Ubqlnl UTSW 7 104149650 missense probably damaging 0.98
R1885:Ubqlnl UTSW 7 104150065 missense possibly damaging 0.88
R1987:Ubqlnl UTSW 7 104148485 missense probably benign
R2151:Ubqlnl UTSW 7 104148683 missense probably benign 0.00
R2152:Ubqlnl UTSW 7 104148683 missense probably benign 0.00
R2153:Ubqlnl UTSW 7 104148683 missense probably benign 0.00
R3712:Ubqlnl UTSW 7 104149138 missense probably benign 0.03
R3914:Ubqlnl UTSW 7 104149606 missense probably benign
R4367:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4404:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4405:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4406:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4407:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4449:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4458:Ubqlnl UTSW 7 104149189 missense probably benign 0.01
R4508:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4516:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4517:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4518:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4522:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4523:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4524:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4529:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4531:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4738:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4739:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R4740:Ubqlnl UTSW 7 104149718 missense probably benign 0.00
R5339:Ubqlnl UTSW 7 104149765 missense probably benign 0.00
R5357:Ubqlnl UTSW 7 104148931 missense probably damaging 1.00
R5386:Ubqlnl UTSW 7 104149217 missense probably benign 0.01
R5542:Ubqlnl UTSW 7 104149697 nonsense probably null
R5588:Ubqlnl UTSW 7 104149132 missense probably damaging 1.00
R6058:Ubqlnl UTSW 7 104148752 missense probably benign
R6084:Ubqlnl UTSW 7 104148698 missense probably benign 0.01
R6207:Ubqlnl UTSW 7 104148708 missense possibly damaging 0.73
R6794:Ubqlnl UTSW 7 104148785 missense probably benign 0.34
R7500:Ubqlnl UTSW 7 104148841 missense probably damaging 1.00
R7575:Ubqlnl UTSW 7 104148490 missense probably damaging 1.00
Z1088:Ubqlnl UTSW 7 104149993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTCAGCCATGTCTTGCACATTC -3'
(R):5'- CCAAAGCAATGTCTGCGCTGTTC -3'

Sequencing Primer
(F):5'- CAGGTCCAGGGCACTATATCAG -3'
(R):5'- GCCTCAAGTTGATAAGGATACTACC -3'
Posted On2013-05-23