Incidental Mutation 'R0066:Tulp4'
ID41124
Institutional Source Beutler Lab
Gene Symbol Tulp4
Ensembl Gene ENSMUSG00000034377
Gene Nametubby like protein 4
Synonyms2210038L17Rik, 1110057P05Rik
MMRRC Submission 038357-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.452) question?
Stock #R0066 (G1)
Quality Score156
Status Validated
Chromosome17
Chromosomal Location6106437-6251128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6201733 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 60 (N60I)
Ref Sequence ENSEMBL: ENSMUSP00000123218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039655] [ENSMUST00000142030] [ENSMUST00000149756]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039655
AA Change: N253I

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049248
Gene: ENSMUSG00000034377
AA Change: N253I

DomainStartEndE-ValueType
WD40 71 110 2.49e-1 SMART
Blast:WD40 113 153 9e-21 BLAST
WD40 159 195 1.84e1 SMART
low complexity region 226 238 N/A INTRINSIC
Blast:WD40 275 306 8e-8 BLAST
Blast:WD40 330 371 1e-14 BLAST
SOCS_box 374 411 2.31e-1 SMART
SCOP:d1c8za_ 418 505 1e-18 SMART
low complexity region 509 518 N/A INTRINSIC
low complexity region 528 547 N/A INTRINSIC
SCOP:d1c8za_ 594 669 8e-12 SMART
low complexity region 770 789 N/A INTRINSIC
low complexity region 837 864 N/A INTRINSIC
low complexity region 1021 1026 N/A INTRINSIC
low complexity region 1041 1056 N/A INTRINSIC
low complexity region 1174 1181 N/A INTRINSIC
low complexity region 1188 1197 N/A INTRINSIC
Pfam:Tub 1346 1543 2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141059
Predicted Effect probably benign
Transcript: ENSMUST00000142030
AA Change: N60I

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120358
Gene: ENSMUSG00000034377
AA Change: N60I

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000149756
AA Change: N60I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123218
Gene: ENSMUSG00000034377
AA Change: N60I

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
Blast:WD40 82 113 6e-8 BLAST
Blast:WD40 137 178 1e-14 BLAST
SOCS_box 181 218 2.31e-1 SMART
SCOP:d1c8za_ 225 312 2e-18 SMART
low complexity region 316 325 N/A INTRINSIC
low complexity region 335 354 N/A INTRINSIC
SCOP:d1c8za_ 401 476 9e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 644 671 N/A INTRINSIC
low complexity region 828 833 N/A INTRINSIC
low complexity region 848 863 N/A INTRINSIC
low complexity region 981 988 N/A INTRINSIC
low complexity region 995 1004 N/A INTRINSIC
coiled coil region 1187 1215 N/A INTRINSIC
Pfam:Tub 1224 1350 5.3e-26 PFAM
Meta Mutation Damage Score 0.0757 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.0%
Validation Efficiency 100% (107/107)
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik A G 9: 22,207,881 noncoding transcript Het
5530400C23Rik A T 6: 133,292,324 probably benign Het
Aco2 T C 15: 81,903,465 probably benign Het
Arap3 A T 18: 37,996,707 S134T probably benign Het
Arsa T A 15: 89,474,336 M288L possibly damaging Het
Atg2b A T 12: 105,648,449 D1074E probably benign Het
Baiap2l1 A T 5: 144,284,562 I174N probably damaging Het
Bpifb9a A T 2: 154,266,841 N421Y possibly damaging Het
Btn2a2 T A 13: 23,478,485 I432L probably benign Het
Ccdc150 A G 1: 54,356,691 I778V probably benign Het
Cd200r2 G A 16: 44,909,674 V194I possibly damaging Het
Cep350 A C 1: 155,911,218 L1421R probably damaging Het
Col24a1 G A 3: 145,545,144 A1633T probably damaging Het
Col6a6 A T 9: 105,702,213 C1938S probably damaging Het
Cspg4 A T 9: 56,888,134 D1051V probably damaging Het
Cstf1 T A 2: 172,373,056 N32K probably benign Het
Ctrb1 G A 8: 111,686,637 R248* probably null Het
Cyp2d11 T A 15: 82,391,757 M208L probably benign Het
Dbt A G 3: 116,543,829 Q334R probably benign Het
Dcaf12 A G 4: 41,298,338 V270A probably damaging Het
Dis3l T A 9: 64,319,165 N361I probably benign Het
Dnah10 A T 5: 124,763,076 D1315V probably benign Het
Dnah11 A G 12: 118,126,886 F1080S probably benign Het
Dnm3 A G 1: 162,407,361 V70A probably damaging Het
Dpy19l1 A C 9: 24,414,409 M700R possibly damaging Het
Dpy19l2 G A 9: 24,646,383 probably benign Het
Dst C A 1: 34,189,553 H2254N possibly damaging Het
Epm2aip1 A G 9: 111,272,463 N168S probably benign Het
Fchsd2 A G 7: 101,278,424 Y691C possibly damaging Het
Fndc8 A T 11: 82,897,572 D76V probably benign Het
Frmd4a T C 2: 4,473,152 L48P probably damaging Het
Gimap6 T A 6: 48,702,470 I211F probably damaging Het
Gm15130 A G 2: 111,138,939 probably benign Het
Gm43302 T A 5: 105,290,900 I41F probably damaging Het
Gm5698 C T 1: 30,977,533 V146I probably benign Het
Gpatch1 G A 7: 35,287,227 S768L probably damaging Het
Grb14 T G 2: 64,938,492 probably null Het
Hnrnpd T C 5: 99,964,701 E222G probably damaging Het
Il4ra C T 7: 125,576,231 P537L possibly damaging Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kcnh4 T C 11: 100,757,800 H26R probably benign Het
Kctd2 T G 11: 115,429,517 probably benign Het
Khdrbs3 T A 15: 68,995,037 probably benign Het
Macf1 G A 4: 123,432,150 Q3066* probably null Het
Mfn2 G A 4: 147,885,445 probably benign Het
Mmab T C 5: 114,436,465 probably benign Het
Mrc1 T C 2: 14,261,200 S310P probably benign Het
Mrps21 T C 3: 95,862,885 Y44C probably null Het
Myh10 T A 11: 68,699,491 F121Y probably damaging Het
Myo1f A G 17: 33,601,703 D840G probably damaging Het
Neb T A 2: 52,306,530 D553V probably damaging Het
Nol6 G T 4: 41,119,572 probably benign Het
Npr2 G T 4: 43,632,329 V49L probably benign Het
Ntsr2 T C 12: 16,654,119 I207T probably benign Het
Nwd1 T A 8: 72,711,856 S1552T probably benign Het
Oas3 T A 5: 120,758,875 I894F probably damaging Het
Olfr169 T A 16: 19,566,049 Y278F probably damaging Het
Olfr456 A T 6: 42,486,935 M86K probably benign Het
Olfr736 T A 14: 50,393,202 F149I probably benign Het
Olfr983 T C 9: 40,092,687 N93S possibly damaging Het
Oprd1 A G 4: 132,113,988 F220L probably benign Het
Pkd1l3 G T 8: 109,620,471 G159C unknown Het
Plcb4 T C 2: 135,961,769 S521P probably benign Het
Plcl1 A T 1: 55,713,475 I993F probably damaging Het
Plcxd1 T A 5: 110,101,502 V65E probably damaging Het
Plekha7 T C 7: 116,157,508 S640G probably damaging Het
Ptprn2 A C 12: 117,276,602 N993T probably benign Het
Rabepk T C 2: 34,795,306 D26G possibly damaging Het
Reck A G 4: 43,930,936 N646D probably damaging Het
Rfx2 A T 17: 56,786,736 probably benign Het
Ripk2 G A 4: 16,123,868 Q436* probably null Het
Ryr1 C T 7: 29,005,567 probably benign Het
Sema6b A G 17: 56,128,271 V324A possibly damaging Het
Sik2 C A 9: 50,998,533 M73I probably benign Het
Slc39a6 T C 18: 24,599,269 K321E probably damaging Het
Slc7a4 C A 16: 17,574,011 V520F probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spink14 T C 18: 44,028,763 V2A probably benign Het
Sptan1 C A 2: 30,003,667 probably benign Het
Stab1 C T 14: 31,157,070 probably benign Het
Tbc1d17 C T 7: 44,844,071 probably benign Het
Tbcd T A 11: 121,503,764 L49* probably null Het
Tmco6 A G 18: 36,742,107 T477A probably benign Het
Tmem208 C T 8: 105,328,225 A53V probably benign Het
Tpp2 A G 1: 43,981,748 T837A possibly damaging Het
Ubqlnl A T 7: 104,148,938 W451R probably damaging Het
Usp53 G T 3: 122,953,307 C363* probably null Het
Usp7 A T 16: 8,691,418 H1017Q probably benign Het
Utp4 A G 8: 106,922,898 T660A possibly damaging Het
Vmn1r194 A T 13: 22,244,471 Y86F probably benign Het
Vmn1r195 A T 13: 22,279,239 H293L possibly damaging Het
Vmn1r231 T C 17: 20,889,736 R306G probably benign Het
Vmn2r63 T C 7: 42,927,090 probably benign Het
Vmn2r77 T C 7: 86,800,756 V70A probably benign Het
Vmn2r85 T C 10: 130,425,901 D189G probably damaging Het
Vps8 A G 16: 21,477,523 E515G possibly damaging Het
Wdr18 C A 10: 79,961,103 Y104* probably null Het
Wnk4 A T 11: 101,265,435 D43V probably damaging Het
Xab2 A T 8: 3,613,880 N346K probably damaging Het
Xirp2 T C 2: 67,512,140 V1575A possibly damaging Het
Zdhhc12 C T 2: 30,092,535 R50H probably damaging Het
Zdhhc8 A G 16: 18,225,200 S379P probably benign Het
Zfp458 G A 13: 67,259,609 Q58* probably null Het
Zfp747 A T 7: 127,374,600 S133T probably benign Het
Other mutations in Tulp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Tulp4 APN 17 6139076 missense probably damaging 0.97
IGL02503:Tulp4 APN 17 6213391 missense probably damaging 0.99
IGL03012:Tulp4 APN 17 6213379 splice site probably benign
IGL03219:Tulp4 APN 17 6139010 missense probably damaging 1.00
tuba_mirum UTSW 17 6201819 missense probably damaging 1.00
R0066:Tulp4 UTSW 17 6201733 missense probably damaging 0.99
R0711:Tulp4 UTSW 17 6139112 missense possibly damaging 0.94
R1718:Tulp4 UTSW 17 6222440 missense probably benign 0.39
R1736:Tulp4 UTSW 17 6233215 missense possibly damaging 0.66
R1775:Tulp4 UTSW 17 6139046 missense probably damaging 0.96
R1793:Tulp4 UTSW 17 6139112 missense possibly damaging 0.94
R3160:Tulp4 UTSW 17 6198708 start codon destroyed probably null 0.94
R3162:Tulp4 UTSW 17 6198708 start codon destroyed probably null 0.94
R3431:Tulp4 UTSW 17 6206964 missense probably benign 0.03
R4081:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R4082:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R4610:Tulp4 UTSW 17 6198833 missense probably damaging 0.96
R4963:Tulp4 UTSW 17 6198813 missense probably damaging 1.00
R4966:Tulp4 UTSW 17 6198813 missense probably damaging 1.00
R5386:Tulp4 UTSW 17 6236293 missense probably damaging 1.00
R6019:Tulp4 UTSW 17 6233215 missense possibly damaging 0.66
R6275:Tulp4 UTSW 17 6198736 missense probably damaging 1.00
R6294:Tulp4 UTSW 17 6201819 missense probably damaging 1.00
R6587:Tulp4 UTSW 17 6231871 missense possibly damaging 0.62
R6680:Tulp4 UTSW 17 6139037 missense probably damaging 1.00
R7030:Tulp4 UTSW 17 6214666 missense probably damaging 1.00
R7068:Tulp4 UTSW 17 6185289 missense probably damaging 1.00
R7109:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R7110:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R7229:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R7230:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R7231:Tulp4 UTSW 17 6236235 missense probably benign 0.03
R7438:Tulp4 UTSW 17 6198708 missense probably benign 0.42
R7750:Tulp4 UTSW 17 6233124 missense probably damaging 1.00
X0067:Tulp4 UTSW 17 6206923 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCCATTCCAGGCCAGAGTGAGC -3'
(R):5'- CAGCTACATGGGAAGGCACCAG -3'

Sequencing Primer
(F):5'- aaaagcccactccattccc -3'
(R):5'- GGAAGGCACCAGCTTGC -3'
Posted On2013-05-23