Incidental Mutation 'R0097:Tgfbr1'
ID41147
Institutional Source Beutler Lab
Gene Symbol Tgfbr1
Ensembl Gene ENSMUSG00000007613
Gene Nametransforming growth factor, beta receptor I
SynonymsTbetaRI, ALK5, TbetaR-I, Alk-5
MMRRC Submission 038383-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0097 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location47353222-47414931 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 47403451 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 283 (L283*)
Ref Sequence ENSEMBL: ENSMUSP00000123761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007757] [ENSMUST00000044234] [ENSMUST00000107725] [ENSMUST00000126171]
Predicted Effect probably null
Transcript: ENSMUST00000007757
AA Change: L352*
SMART Domains Protein: ENSMUSP00000007757
Gene: ENSMUSG00000007613
AA Change: L352*

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 13 24 N/A INTRINSIC
Pfam:Activin_recp 30 110 2.7e-16 PFAM
transmembrane domain 126 148 N/A INTRINSIC
GS 175 205 1.01e-14 SMART
Blast:STYKc 207 492 7e-31 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000044234
AA Change: L348*
SMART Domains Protein: ENSMUSP00000048501
Gene: ENSMUSG00000007613
AA Change: L348*

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 13 24 N/A INTRINSIC
Pfam:Activin_recp 30 110 1.6e-14 PFAM
transmembrane domain 122 144 N/A INTRINSIC
GS 171 201 1.01e-14 SMART
Blast:STYKc 203 488 8e-31 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000107725
AA Change: L269*
SMART Domains Protein: ENSMUSP00000103353
Gene: ENSMUSG00000007613
AA Change: L269*

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
GS 92 122 1.01e-14 SMART
Blast:STYKc 124 409 3e-31 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000126171
AA Change: L283*
SMART Domains Protein: ENSMUSP00000123761
Gene: ENSMUSG00000007613
AA Change: L283*

DomainStartEndE-ValueType
PDB:3KFD|L 1 45 3e-26 PDB
transmembrane domain 57 79 N/A INTRINSIC
GS 106 136 1.01e-14 SMART
Blast:STYKc 138 423 3e-31 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: This gene encodes a member of the transforming growth factor beta (TGF-beta) receptor family of proteins. These proteins comprise one component of the TGF-beta signaling pathway, which transduces extracellular signals into gene expression changes to regulate a wide range of cellular responses, including proliferation, migration, differentiation and apoptosis. Homozygous knockout mice for this gene exhibit impaired angiogenesis and embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for some targeted null mutations exhibit defects of the yolk sac and placenta, lack circulating erythrocytes, and die at midgestation. Mutant endothelial cells show enhanced proliferation, improper migration, and reduced fibronectin production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,412,480 I353K probably benign Het
5830473C10Rik T A 5: 90,584,936 S535R probably benign Het
Arfgap2 T A 2: 91,274,815 V422E probably benign Het
Baz1b T C 5: 135,198,259 S105P probably benign Het
Bbs10 T C 10: 111,298,844 V41A probably damaging Het
Cacna1s T A 1: 136,100,622 M899K possibly damaging Het
Ccnd2 G A 6: 127,146,052 A180V probably benign Het
Cldnd1 A G 16: 58,729,715 N87S possibly damaging Het
Cyp2c54 T A 19: 40,047,658 probably benign Het
Cyp2c54 G T 19: 40,047,659 probably benign Het
Dab2ip G A 2: 35,718,916 V629M possibly damaging Het
Ddx41 A T 13: 55,535,878 probably benign Het
Dmrta1 A T 4: 89,688,872 R188S probably benign Het
Eml3 T A 19: 8,936,651 F465L probably benign Het
Gm13128 T C 4: 144,331,287 S155P probably benign Het
Gm9938 T A 19: 23,724,464 probably benign Het
Gpr87 G A 3: 59,179,085 T333I probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Llgl2 T A 11: 115,844,497 Y59* probably null Het
Lzic A G 4: 149,488,076 E41G probably damaging Het
Mprip T A 11: 59,758,491 L1007Q possibly damaging Het
Mtfr2 T A 10: 20,348,376 S19T probably damaging Het
Mycbp2 A T 14: 103,155,762 M3121K probably damaging Het
Myocd T A 11: 65,179,014 M667L possibly damaging Het
Narfl T C 17: 25,777,002 S67P possibly damaging Het
Ncam2 A G 16: 81,517,537 D467G probably damaging Het
Neb T C 2: 52,204,894 N4882S probably damaging Het
Neu2 A G 1: 87,597,466 D391G probably benign Het
Nol4 C A 18: 22,719,141 A456S probably benign Het
Olfr1025-ps1 T C 2: 85,918,840 V305A probably benign Het
Padi6 C T 4: 140,730,957 V513M probably benign Het
Pign G A 1: 105,587,976 probably benign Het
Plpp2 T C 10: 79,530,537 E91G possibly damaging Het
Pnp T A 14: 50,951,416 V222D probably damaging Het
Pnp2 C T 14: 50,963,501 R148C probably benign Het
Prss38 A G 11: 59,375,608 L8S possibly damaging Het
Rab5b A T 10: 128,682,940 F108I probably damaging Het
Rbbp5 T A 1: 132,490,489 H15Q possibly damaging Het
Rhox4f A C X: 37,607,469 V15G probably benign Het
Rsl1 A C 13: 67,181,902 Q138P probably damaging Het
Ryr3 T C 2: 112,800,055 D2157G probably damaging Het
Secisbp2l T C 2: 125,771,456 D206G probably damaging Het
Sh3pxd2b T A 11: 32,403,978 I182N probably damaging Het
Slc3a1 A T 17: 85,032,860 I237F probably damaging Het
Svs3b T C 2: 164,256,239 E54G probably damaging Het
T A T 17: 8,439,901 probably benign Het
Tenm4 A T 7: 96,892,926 D1882V probably damaging Het
Tppp3 C T 8: 105,467,922 A149T probably benign Het
Ubp1 T C 9: 113,973,507 probably benign Het
Ushbp1 C T 8: 71,390,713 C314Y probably damaging Het
Vav2 A T 2: 27,299,362 probably benign Het
Vmn1r228 T C 17: 20,776,363 M298V probably benign Het
Zmpste24 A T 4: 121,095,543 probably benign Het
Other mutations in Tgfbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Tgfbr1 APN 4 47383992 missense probably benign 0.00
IGL00757:Tgfbr1 APN 4 47405581 missense probably damaging 1.00
IGL02001:Tgfbr1 APN 4 47403388 missense probably damaging 1.00
IGL02207:Tgfbr1 APN 4 47410785 utr 3 prime probably benign
IGL02338:Tgfbr1 APN 4 47393490 critical splice donor site probably null
PIT4480001:Tgfbr1 UTSW 4 47402955 missense probably benign 0.44
R0097:Tgfbr1 UTSW 4 47403451 nonsense probably null
R1299:Tgfbr1 UTSW 4 47396587 critical splice donor site probably null
R1444:Tgfbr1 UTSW 4 47393259 missense probably benign
R1530:Tgfbr1 UTSW 4 47410688 missense probably damaging 1.00
R1591:Tgfbr1 UTSW 4 47403471 missense probably damaging 1.00
R1611:Tgfbr1 UTSW 4 47396526 missense probably damaging 1.00
R2327:Tgfbr1 UTSW 4 47402833 missense probably damaging 1.00
R4352:Tgfbr1 UTSW 4 47402863 missense probably damaging 1.00
R4736:Tgfbr1 UTSW 4 47383835 missense probably benign
R5180:Tgfbr1 UTSW 4 47383948 nonsense probably null
R5907:Tgfbr1 UTSW 4 47396555 missense probably damaging 1.00
R6462:Tgfbr1 UTSW 4 47402846 missense probably damaging 1.00
R6842:Tgfbr1 UTSW 4 47383757 missense probably damaging 1.00
R7017:Tgfbr1 UTSW 4 47410728 missense probably damaging 0.99
R7206:Tgfbr1 UTSW 4 47402941 missense probably damaging 1.00
R7402:Tgfbr1 UTSW 4 47405623 missense probably damaging 1.00
R7862:Tgfbr1 UTSW 4 47403489 missense probably damaging 0.99
R7945:Tgfbr1 UTSW 4 47403489 missense probably damaging 0.99
RF013:Tgfbr1 UTSW 4 47353354 missense unknown
Z1176:Tgfbr1 UTSW 4 47353790 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCTTTCGACACAGTGGTTTGCTGAG -3'
(R):5'- TCCCGAGGATCAGAAAAGGGTTCC -3'

Sequencing Primer
(F):5'- ATAGGTGATGTAGCTCAAGTGC -3'
(R):5'- GGGAGGGTTGGTAACATTAACC -3'
Posted On2013-05-23