Mutagenetix > Incidental Mutation

Incidental Mutation 'R0097:Padi6'

41150

Institutional Source

Beutler Lab

Gene Symbol

Padi6

Ensembl Gene

ENSMUSG00000040935

Gene Name

peptidyl arginine deiminase, type VI

Synonyms

Padi5, Pad6, ePAD

MMRRC Submission

038383-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0097 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

140727355-140742643 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 140730957 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 513 (V513M)

Ref Sequence

ENSEMBL: ENSMUSP00000044044 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038749] [ENSMUST00000130267]

AlphaFold

Q8K3V4

Predicted Effect

probably benign
Transcript: ENSMUST00000038749
AA Change: V513M

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000044044
Gene: ENSMUSG00000040935
AA Change: V513M

Domain	Start	End	E-Value	Type
Pfam:PAD_N	1	112	5.6e-38	PFAM
Pfam:PAD_M	114	269	6e-53	PFAM
Pfam:PAD	280	679	4.7e-149	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125046

Predicted Effect

probably benign
Transcript: ENSMUST00000130267

SMART Domains

Protein: ENSMUSP00000123490
Gene: ENSMUSG00000040935

Domain	Start	End	E-Value	Type
Pfam:PAD_M	39	191	1.1e-57	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. This protein may play a role in cytoskeletal reorganization in the egg and in early embryo development. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit altered oocyte cytoplasmic structures that lead to a failure of zygotes to progress beyond the 2 cell stage and female infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	T	3: 124,412,480	I353K	probably benign	Het
5830473C10Rik	T	A	5: 90,584,936	S535R	probably benign	Het
Arfgap2	T	A	2: 91,274,815	V422E	probably benign	Het
Baz1b	T	C	5: 135,198,259	S105P	probably benign	Het
Bbs10	T	C	10: 111,298,844	V41A	probably damaging	Het
Cacna1s	T	A	1: 136,100,622	M899K	possibly damaging	Het
Ccnd2	G	A	6: 127,146,052	A180V	probably benign	Het
Cldnd1	A	G	16: 58,729,715	N87S	possibly damaging	Het
Cyp2c54	T	A	19: 40,047,658		probably benign	Het
Cyp2c54	G	T	19: 40,047,659		probably benign	Het
Dab2ip	G	A	2: 35,718,916	V629M	possibly damaging	Het
Ddx41	A	T	13: 55,535,878		probably benign	Het
Dmrta1	A	T	4: 89,688,872	R188S	probably benign	Het
Eml3	T	A	19: 8,936,651	F465L	probably benign	Het
Gm13128	T	C	4: 144,331,287	S155P	probably benign	Het
Gm9938	T	A	19: 23,724,464		probably benign	Het
Gpr87	G	A	3: 59,179,085	T333I	probably damaging	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Llgl2	T	A	11: 115,844,497	Y59*	probably null	Het
Lzic	A	G	4: 149,488,076	E41G	probably damaging	Het
Mprip	T	A	11: 59,758,491	L1007Q	possibly damaging	Het
Mtfr2	T	A	10: 20,348,376	S19T	probably damaging	Het
Mycbp2	A	T	14: 103,155,762	M3121K	probably damaging	Het
Myocd	T	A	11: 65,179,014	M667L	possibly damaging	Het
Narfl	T	C	17: 25,777,002	S67P	possibly damaging	Het
Ncam2	A	G	16: 81,517,537	D467G	probably damaging	Het
Neb	T	C	2: 52,204,894	N4882S	probably damaging	Het
Neu2	A	G	1: 87,597,466	D391G	probably benign	Het
Nol4	C	A	18: 22,719,141	A456S	probably benign	Het
Olfr1025-ps1	T	C	2: 85,918,840	V305A	probably benign	Het
Pign	G	A	1: 105,587,976		probably benign	Het
Plpp2	T	C	10: 79,530,537	E91G	possibly damaging	Het
Pnp	T	A	14: 50,951,416	V222D	probably damaging	Het
Pnp2	C	T	14: 50,963,501	R148C	probably benign	Het
Prss38	A	G	11: 59,375,608	L8S	possibly damaging	Het
Rab5b	A	T	10: 128,682,940	F108I	probably damaging	Het
Rbbp5	T	A	1: 132,490,489	H15Q	possibly damaging	Het
Rhox4f	A	C	X: 37,607,469	V15G	probably benign	Het
Rsl1	A	C	13: 67,181,902	Q138P	probably damaging	Het
Ryr3	T	C	2: 112,800,055	D2157G	probably damaging	Het
Secisbp2l	T	C	2: 125,771,456	D206G	probably damaging	Het
Sh3pxd2b	T	A	11: 32,403,978	I182N	probably damaging	Het
Slc3a1	A	T	17: 85,032,860	I237F	probably damaging	Het
Svs3b	T	C	2: 164,256,239	E54G	probably damaging	Het
T	A	T	17: 8,439,901		probably benign	Het
Tenm4	A	T	7: 96,892,926	D1882V	probably damaging	Het
Tgfbr1	T	A	4: 47,403,451	L283*	probably null	Het
Tppp3	C	T	8: 105,467,922	A149T	probably benign	Het
Ubp1	T	C	9: 113,973,507		probably benign	Het
Ushbp1	C	T	8: 71,390,713	C314Y	probably damaging	Het
Vav2	A	T	2: 27,299,362		probably benign	Het
Vmn1r228	T	C	17: 20,776,363	M298V	probably benign	Het
Zmpste24	A	T	4: 121,095,543		probably benign	Het

Other mutations in Padi6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Padi6	APN	4	140727623	missense	possibly damaging	0.56
IGL01013:Padi6	APN	4	140729003	missense	probably damaging	0.98
IGL01068:Padi6	APN	4	140730953	missense	possibly damaging	0.70
IGL01945:Padi6	APN	4	140741924	missense	probably benign	0.24
streetwise	UTSW	4	140741558	nonsense	probably null
R0097:Padi6	UTSW	4	140730957	missense	probably benign	0.09
R0135:Padi6	UTSW	4	140737352	missense	probably benign	0.04
R0437:Padi6	UTSW	4	140728929	missense	probably benign	0.01
R1581:Padi6	UTSW	4	140735836	missense	probably damaging	1.00
R2024:Padi6	UTSW	4	140728968	missense	possibly damaging	0.78
R3150:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3176:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3177:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3276:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R3277:Padi6	UTSW	4	140735389	missense	probably damaging	1.00
R4168:Padi6	UTSW	4	140741934	missense	probably damaging	0.99
R4727:Padi6	UTSW	4	140731195	missense	probably damaging	1.00
R5063:Padi6	UTSW	4	140741880	missense	probably benign	0.01
R5382:Padi6	UTSW	4	140731210	missense	probably damaging	1.00
R5408:Padi6	UTSW	4	140727685	missense	probably damaging	1.00
R5604:Padi6	UTSW	4	140731162	missense	probably damaging	0.96
R5790:Padi6	UTSW	4	140732258	missense	probably damaging	1.00
R7084:Padi6	UTSW	4	140741558	nonsense	probably null
R7533:Padi6	UTSW	4	140731195	missense	probably damaging	1.00
R7581:Padi6	UTSW	4	140728929	missense	probably benign	0.01
R7662:Padi6	UTSW	4	140728995	missense	probably benign	0.00
R7766:Padi6	UTSW	4	140730975	missense	probably benign	0.02
R7872:Padi6	UTSW	4	140727762	missense	probably damaging	1.00
R8333:Padi6	UTSW	4	140737376	missense	probably damaging	1.00
R8347:Padi6	UTSW	4	140735408	missense	probably benign	0.00
R8550:Padi6	UTSW	4	140732703	missense	probably benign	0.15
R8979:Padi6	UTSW	4	140739163	missense	probably benign	0.03
R9628:Padi6	UTSW	4	140737315	missense	probably damaging	1.00
RF007:Padi6	UTSW	4	140729743	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGGGTGTAAGGTGTCCCAACAATG -3'
(R):5'- CGACCAGAAGGTTGGTGTTAGAGC -3'

Sequencing Primer
(F):5'- agtcataacaatagcaaggttacag -3'
(R):5'- TGGTGTTAGAGCCGGAGAG -3'

Posted On

2013-05-23