Incidental Mutation 'R0097:Gm13128'
ID41151
Institutional Source Beutler Lab
Gene Symbol Gm13128
Ensembl Gene ENSMUSG00000078508
Gene Namepredicted gene 13128
Synonyms
MMRRC Submission 038383-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0097 (G1)
Quality Score173
Status Validated
Chromosome4
Chromosomal Location144330249-144333465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144331287 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 155 (S155P)
Ref Sequence ENSEMBL: ENSMUSP00000101377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105751]
Predicted Effect probably benign
Transcript: ENSMUST00000105751
AA Change: S155P

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000101377
Gene: ENSMUSG00000078508
AA Change: S155P

DomainStartEndE-ValueType
low complexity region 188 200 N/A INTRINSIC
SCOP:d1a4ya_ 205 408 6e-11 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,412,480 I353K probably benign Het
5830473C10Rik T A 5: 90,584,936 S535R probably benign Het
Arfgap2 T A 2: 91,274,815 V422E probably benign Het
Baz1b T C 5: 135,198,259 S105P probably benign Het
Bbs10 T C 10: 111,298,844 V41A probably damaging Het
Cacna1s T A 1: 136,100,622 M899K possibly damaging Het
Ccnd2 G A 6: 127,146,052 A180V probably benign Het
Cldnd1 A G 16: 58,729,715 N87S possibly damaging Het
Cyp2c54 T A 19: 40,047,658 probably benign Het
Cyp2c54 G T 19: 40,047,659 probably benign Het
Dab2ip G A 2: 35,718,916 V629M possibly damaging Het
Ddx41 A T 13: 55,535,878 probably benign Het
Dmrta1 A T 4: 89,688,872 R188S probably benign Het
Eml3 T A 19: 8,936,651 F465L probably benign Het
Gm9938 T A 19: 23,724,464 probably benign Het
Gpr87 G A 3: 59,179,085 T333I probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Llgl2 T A 11: 115,844,497 Y59* probably null Het
Lzic A G 4: 149,488,076 E41G probably damaging Het
Mprip T A 11: 59,758,491 L1007Q possibly damaging Het
Mtfr2 T A 10: 20,348,376 S19T probably damaging Het
Mycbp2 A T 14: 103,155,762 M3121K probably damaging Het
Myocd T A 11: 65,179,014 M667L possibly damaging Het
Narfl T C 17: 25,777,002 S67P possibly damaging Het
Ncam2 A G 16: 81,517,537 D467G probably damaging Het
Neb T C 2: 52,204,894 N4882S probably damaging Het
Neu2 A G 1: 87,597,466 D391G probably benign Het
Nol4 C A 18: 22,719,141 A456S probably benign Het
Olfr1025-ps1 T C 2: 85,918,840 V305A probably benign Het
Padi6 C T 4: 140,730,957 V513M probably benign Het
Pign G A 1: 105,587,976 probably benign Het
Plpp2 T C 10: 79,530,537 E91G possibly damaging Het
Pnp T A 14: 50,951,416 V222D probably damaging Het
Pnp2 C T 14: 50,963,501 R148C probably benign Het
Prss38 A G 11: 59,375,608 L8S possibly damaging Het
Rab5b A T 10: 128,682,940 F108I probably damaging Het
Rbbp5 T A 1: 132,490,489 H15Q possibly damaging Het
Rhox4f A C X: 37,607,469 V15G probably benign Het
Rsl1 A C 13: 67,181,902 Q138P probably damaging Het
Ryr3 T C 2: 112,800,055 D2157G probably damaging Het
Secisbp2l T C 2: 125,771,456 D206G probably damaging Het
Sh3pxd2b T A 11: 32,403,978 I182N probably damaging Het
Slc3a1 A T 17: 85,032,860 I237F probably damaging Het
Svs3b T C 2: 164,256,239 E54G probably damaging Het
T A T 17: 8,439,901 probably benign Het
Tenm4 A T 7: 96,892,926 D1882V probably damaging Het
Tgfbr1 T A 4: 47,403,451 L283* probably null Het
Tppp3 C T 8: 105,467,922 A149T probably benign Het
Ubp1 T C 9: 113,973,507 probably benign Het
Ushbp1 C T 8: 71,390,713 C314Y probably damaging Het
Vav2 A T 2: 27,299,362 probably benign Het
Vmn1r228 T C 17: 20,776,363 M298V probably benign Het
Zmpste24 A T 4: 121,095,543 probably benign Het
Other mutations in Gm13128
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1743:Gm13128 UTSW 4 144333005 missense probably benign 0.03
R3079:Gm13128 UTSW 4 144331528 missense probably damaging 1.00
R3948:Gm13128 UTSW 4 144331306 missense probably benign 0.01
R3954:Gm13128 UTSW 4 144331668 missense probably benign 0.03
R4448:Gm13128 UTSW 4 144332685 missense probably damaging 1.00
R5008:Gm13128 UTSW 4 144331266 missense probably benign 0.02
R5715:Gm13128 UTSW 4 144331300 missense possibly damaging 0.67
R5986:Gm13128 UTSW 4 144332753 missense probably damaging 0.98
R6008:Gm13128 UTSW 4 144331207 missense probably benign 0.08
R6278:Gm13128 UTSW 4 144330267 missense probably damaging 0.98
R6383:Gm13128 UTSW 4 144333147 makesense probably null
R6523:Gm13128 UTSW 4 144331648 missense probably benign 0.42
R6747:Gm13128 UTSW 4 144332978 missense probably benign 0.00
R7276:Gm13128 UTSW 4 144332646 missense possibly damaging 0.67
R7555:Gm13128 UTSW 4 144332741 missense probably benign 0.01
R8213:Gm13128 UTSW 4 144330460 missense probably benign 0.03
Z1177:Gm13128 UTSW 4 144331193 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGGAATGGACACCATGACTTCTGG -3'
(R):5'- AGGTTTGCTCTGGTAACAGCAACAG -3'

Sequencing Primer
(F):5'- ACACCATGACTTCTGGGATATGC -3'
(R):5'- GTCTTCCAAAGATGCGTACTAGC -3'
Posted On2013-05-23