Incidental Mutation 'R0097:Tppp3'
ID41158
Institutional Source Beutler Lab
Gene Symbol Tppp3
Ensembl Gene ENSMUSG00000014846
Gene Nametubulin polymerization-promoting protein family member 3
Synonyms
MMRRC Submission 038383-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R0097 (G1)
Quality Score151
Status Validated
Chromosome8
Chromosomal Location105467493-105471526 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105467922 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 149 (A149T)
Ref Sequence ENSEMBL: ENSMUSP00000135040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014990] [ENSMUST00000044286] [ENSMUST00000067305] [ENSMUST00000109355] [ENSMUST00000176419] [ENSMUST00000177126] [ENSMUST00000212303] [ENSMUST00000213547] [ENSMUST00000216765]
Predicted Effect probably benign
Transcript: ENSMUST00000014990
AA Change: A149T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000014990
Gene: ENSMUSG00000014846
AA Change: A149T

DomainStartEndE-ValueType
Pfam:p25-alpha 11 172 1.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044286
SMART Domains Protein: ENSMUSP00000036471
Gene: ENSMUSG00000039199

DomainStartEndE-ValueType
transmembrane domain 49 71 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
Pfam:zf-DHHC 126 282 2.5e-38 PFAM
low complexity region 359 371 N/A INTRINSIC
low complexity region 383 392 N/A INTRINSIC
low complexity region 395 411 N/A INTRINSIC
low complexity region 414 426 N/A INTRINSIC
low complexity region 468 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067305
SMART Domains Protein: ENSMUSP00000066345
Gene: ENSMUSG00000054320

DomainStartEndE-ValueType
low complexity region 377 389 N/A INTRINSIC
coiled coil region 478 550 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109355
SMART Domains Protein: ENSMUSP00000104979
Gene: ENSMUSG00000054320

DomainStartEndE-ValueType
Pfam:LRR_8 24 84 2.9e-8 PFAM
low complexity region 500 512 N/A INTRINSIC
coiled coil region 601 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176419
AA Change: A149T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000134807
Gene: ENSMUSG00000014846
AA Change: A149T

DomainStartEndE-ValueType
Pfam:p25-alpha 10 174 9e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177126
AA Change: A149T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000135040
Gene: ENSMUSG00000014846
AA Change: A149T

DomainStartEndE-ValueType
Pfam:p25-alpha 10 174 9e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212109
Predicted Effect probably benign
Transcript: ENSMUST00000212303
Predicted Effect probably benign
Transcript: ENSMUST00000213547
Predicted Effect probably benign
Transcript: ENSMUST00000216457
Predicted Effect probably benign
Transcript: ENSMUST00000216765
Meta Mutation Damage Score 0.1367 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,412,480 I353K probably benign Het
5830473C10Rik T A 5: 90,584,936 S535R probably benign Het
Arfgap2 T A 2: 91,274,815 V422E probably benign Het
Baz1b T C 5: 135,198,259 S105P probably benign Het
Bbs10 T C 10: 111,298,844 V41A probably damaging Het
Cacna1s T A 1: 136,100,622 M899K possibly damaging Het
Ccnd2 G A 6: 127,146,052 A180V probably benign Het
Cldnd1 A G 16: 58,729,715 N87S possibly damaging Het
Cyp2c54 T A 19: 40,047,658 probably benign Het
Cyp2c54 G T 19: 40,047,659 probably benign Het
Dab2ip G A 2: 35,718,916 V629M possibly damaging Het
Ddx41 A T 13: 55,535,878 probably benign Het
Dmrta1 A T 4: 89,688,872 R188S probably benign Het
Eml3 T A 19: 8,936,651 F465L probably benign Het
Gm13128 T C 4: 144,331,287 S155P probably benign Het
Gm9938 T A 19: 23,724,464 probably benign Het
Gpr87 G A 3: 59,179,085 T333I probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Llgl2 T A 11: 115,844,497 Y59* probably null Het
Lzic A G 4: 149,488,076 E41G probably damaging Het
Mprip T A 11: 59,758,491 L1007Q possibly damaging Het
Mtfr2 T A 10: 20,348,376 S19T probably damaging Het
Mycbp2 A T 14: 103,155,762 M3121K probably damaging Het
Myocd T A 11: 65,179,014 M667L possibly damaging Het
Narfl T C 17: 25,777,002 S67P possibly damaging Het
Ncam2 A G 16: 81,517,537 D467G probably damaging Het
Neb T C 2: 52,204,894 N4882S probably damaging Het
Neu2 A G 1: 87,597,466 D391G probably benign Het
Nol4 C A 18: 22,719,141 A456S probably benign Het
Olfr1025-ps1 T C 2: 85,918,840 V305A probably benign Het
Padi6 C T 4: 140,730,957 V513M probably benign Het
Pign G A 1: 105,587,976 probably benign Het
Plpp2 T C 10: 79,530,537 E91G possibly damaging Het
Pnp T A 14: 50,951,416 V222D probably damaging Het
Pnp2 C T 14: 50,963,501 R148C probably benign Het
Prss38 A G 11: 59,375,608 L8S possibly damaging Het
Rab5b A T 10: 128,682,940 F108I probably damaging Het
Rbbp5 T A 1: 132,490,489 H15Q possibly damaging Het
Rhox4f A C X: 37,607,469 V15G probably benign Het
Rsl1 A C 13: 67,181,902 Q138P probably damaging Het
Ryr3 T C 2: 112,800,055 D2157G probably damaging Het
Secisbp2l T C 2: 125,771,456 D206G probably damaging Het
Sh3pxd2b T A 11: 32,403,978 I182N probably damaging Het
Slc3a1 A T 17: 85,032,860 I237F probably damaging Het
Svs3b T C 2: 164,256,239 E54G probably damaging Het
T A T 17: 8,439,901 probably benign Het
Tenm4 A T 7: 96,892,926 D1882V probably damaging Het
Tgfbr1 T A 4: 47,403,451 L283* probably null Het
Ubp1 T C 9: 113,973,507 probably benign Het
Ushbp1 C T 8: 71,390,713 C314Y probably damaging Het
Vav2 A T 2: 27,299,362 probably benign Het
Vmn1r228 T C 17: 20,776,363 M298V probably benign Het
Zmpste24 A T 4: 121,095,543 probably benign Het
Other mutations in Tppp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0494:Tppp3 UTSW 8 105468172 missense probably benign 0.02
R0543:Tppp3 UTSW 8 105468208 missense probably benign
R5169:Tppp3 UTSW 8 105467869 missense probably benign 0.06
R7637:Tppp3 UTSW 8 105468292 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TAGGCACTGACTCCCAGACAGATG -3'
(R):5'- ACTAAGCGGTTCAAGGGGAAGTCC -3'

Sequencing Primer
(F):5'- AAGCTCTTGGTGGCAGATCC -3'
(R):5'- TGATGCCATCTGCCAGC -3'
Posted On2013-05-23