Mutagenetix > Incidental Mutations

Incidental Mutation 'R0097:Llgl2'

41167

Institutional Source

Beutler Lab

Gene Symbol

Llgl2

Ensembl Gene

ENSMUSG00000020782

Gene Name

LLGL2 scribble cell polarity complex component

Synonyms

9130006H11Rik

MMRRC Submission

038383-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.691) question?

Stock #

R0097 (G1)

Quality Score

204

Status

Validated

Chromosome

Chromosomal Location

115824049-115855780 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 115844497 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 59 (Y59*)

Ref Sequence

ENSEMBL: ENSMUSP00000136054 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103032] [ENSMUST00000133250] [ENSMUST00000137900] [ENSMUST00000155878] [ENSMUST00000172552] [ENSMUST00000173289] [ENSMUST00000177736]

Predicted Effect

probably null
Transcript: ENSMUST00000103032
AA Change: Y59*

SMART Domains

Protein: ENSMUSP00000099321
Gene: ENSMUSG00000020782
AA Change: Y59*

Domain	Start	End	E-Value	Type
WD40	24	60	9.17e1	SMART
WD40	62	101	7.96e0	SMART
Blast:WD40	112	157	6e-20	BLAST
WD40	181	217	3.96e1	SMART
WD40	221	258	5.7e1	SMART
Pfam:LLGL	268	372	3.2e-47	PFAM
WD40	411	451	1.38e0	SMART
Blast:WD40	489	532	3e-12	BLAST
low complexity region	536	547	N/A	INTRINSIC
Blast:WD40	576	615	2e-10	BLAST
low complexity region	649	668	N/A	INTRINSIC
Blast:WD40	830	879	2e-10	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000133250
AA Change: Y59*

SMART Domains

Protein: ENSMUSP00000118344
Gene: ENSMUSG00000020782
AA Change: Y59*

Domain	Start	End	E-Value	Type
Blast:WD40	13	60	2e-20	BLAST
SCOP:d1gxra_	19	118	5e-8	SMART
Blast:WD40	62	101	4e-22	BLAST
Blast:WD40	112	146	1e-15	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000137900
AA Change: Y59*

SMART Domains

Protein: ENSMUSP00000119675
Gene: ENSMUSG00000020782
AA Change: Y59*

Domain	Start	End	E-Value	Type
Blast:WD40	13	60	3e-20	BLAST
SCOP:d1gxra_	19	158	7e-9	SMART
Blast:WD40	62	101	6e-22	BLAST
Blast:WD40	112	157	2e-22	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000155878
AA Change: Y59*

SMART Domains

Protein: ENSMUSP00000117649
Gene: ENSMUSG00000020782
AA Change: Y59*

Domain	Start	End	E-Value	Type
Blast:WD40	13	60	1e-20	BLAST
SCOP:d1gxra_	19	118	3e-8	SMART
Blast:WD40	62	101	3e-22	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000172552
AA Change: Y59*

SMART Domains

Protein: ENSMUSP00000133803
Gene: ENSMUSG00000020782
AA Change: Y59*

Domain	Start	End	E-Value	Type
Blast:WD40	13	60	4e-21	BLAST
SCOP:d1gxra_	19	101	1e-7	SMART
Blast:WD40	62	101	2e-22	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000173289
AA Change: Y59*

SMART Domains

Protein: ENSMUSP00000133790
Gene: ENSMUSG00000020782
AA Change: Y59*

Domain	Start	End	E-Value	Type
Blast:WD40	13	60	2e-20	BLAST
SCOP:d1gxra_	19	118	5e-8	SMART
Blast:WD40	62	101	4e-22	BLAST
Blast:WD40	112	148	4e-17	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000177736
AA Change: Y59*

SMART Domains

Protein: ENSMUSP00000136054
Gene: ENSMUSG00000020782
AA Change: Y59*

Domain	Start	End	E-Value	Type
WD40	24	60	5.9e-1	SMART
WD40	62	101	5.2e-2	SMART
Blast:WD40	112	157	6e-20	BLAST
WD40	181	217	2.5e-1	SMART
WD40	221	258	3.6e-1	SMART
Pfam:LLGL	271	372	6.2e-41	PFAM
WD40	411	451	8.8e-3	SMART
Blast:WD40	489	532	3e-12	BLAST
low complexity region	536	547	N/A	INTRINSIC
Blast:WD40	576	615	2e-10	BLAST
low complexity region	649	668	N/A	INTRINSIC
Blast:WD40	854	903	2e-10	BLAST

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The lethal (2) giant larvae protein of Drosophila plays a role in asymmetric cell division, epithelial cell polarity, and cell migration. This human gene encodes a protein similar to lethal (2) giant larvae of Drosophila. In fly, the protein's ability to localize cell fate determinants is regulated by the atypical protein kinase C (aPKC). In human, this protein interacts with aPKC-containing complexes and is cortically localized in mitotic cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit abnormal branching morphogenesis of the placental labyrinth layer and are born as runts but catch up in size by adulthood. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	T	3: 124,412,480	I353K	probably benign	Het
5830473C10Rik	T	A	5: 90,584,936	S535R	probably benign	Het
Arfgap2	T	A	2: 91,274,815	V422E	probably benign	Het
Baz1b	T	C	5: 135,198,259	S105P	probably benign	Het
Bbs10	T	C	10: 111,298,844	V41A	probably damaging	Het
Cacna1s	T	A	1: 136,100,622	M899K	possibly damaging	Het
Ccnd2	G	A	6: 127,146,052	A180V	probably benign	Het
Cldnd1	A	G	16: 58,729,715	N87S	possibly damaging	Het
Cyp2c54	T	A	19: 40,047,658		probably benign	Het
Cyp2c54	G	T	19: 40,047,659		probably benign	Het
Dab2ip	G	A	2: 35,718,916	V629M	possibly damaging	Het
Ddx41	A	T	13: 55,535,878		probably benign	Het
Dmrta1	A	T	4: 89,688,872	R188S	probably benign	Het
Eml3	T	A	19: 8,936,651	F465L	probably benign	Het
Gm13128	T	C	4: 144,331,287	S155P	probably benign	Het
Gm9938	T	A	19: 23,724,464		probably benign	Het
Gpr87	G	A	3: 59,179,085	T333I	probably damaging	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Lzic	A	G	4: 149,488,076	E41G	probably damaging	Het
Mprip	T	A	11: 59,758,491	L1007Q	possibly damaging	Het
Mtfr2	T	A	10: 20,348,376	S19T	probably damaging	Het
Mycbp2	A	T	14: 103,155,762	M3121K	probably damaging	Het
Myocd	T	A	11: 65,179,014	M667L	possibly damaging	Het
Narfl	T	C	17: 25,777,002	S67P	possibly damaging	Het
Ncam2	A	G	16: 81,517,537	D467G	probably damaging	Het
Neb	T	C	2: 52,204,894	N4882S	probably damaging	Het
Neu2	A	G	1: 87,597,466	D391G	probably benign	Het
Nol4	C	A	18: 22,719,141	A456S	probably benign	Het
Olfr1025-ps1	T	C	2: 85,918,840	V305A	probably benign	Het
Padi6	C	T	4: 140,730,957	V513M	probably benign	Het
Pign	G	A	1: 105,587,976		probably benign	Het
Plpp2	T	C	10: 79,530,537	E91G	possibly damaging	Het
Pnp	T	A	14: 50,951,416	V222D	probably damaging	Het
Pnp2	C	T	14: 50,963,501	R148C	probably benign	Het
Prss38	A	G	11: 59,375,608	L8S	possibly damaging	Het
Rab5b	A	T	10: 128,682,940	F108I	probably damaging	Het
Rbbp5	T	A	1: 132,490,489	H15Q	possibly damaging	Het
Rhox4f	A	C	X: 37,607,469	V15G	probably benign	Het
Rsl1	A	C	13: 67,181,902	Q138P	probably damaging	Het
Ryr3	T	C	2: 112,800,055	D2157G	probably damaging	Het
Secisbp2l	T	C	2: 125,771,456	D206G	probably damaging	Het
Sh3pxd2b	T	A	11: 32,403,978	I182N	probably damaging	Het
Slc3a1	A	T	17: 85,032,860	I237F	probably damaging	Het
Svs3b	T	C	2: 164,256,239	E54G	probably damaging	Het
T	A	T	17: 8,439,901		probably benign	Het
Tenm4	A	T	7: 96,892,926	D1882V	probably damaging	Het
Tgfbr1	T	A	4: 47,403,451	L283*	probably null	Het
Tppp3	C	T	8: 105,467,922	A149T	probably benign	Het
Ubp1	T	C	9: 113,973,507		probably benign	Het
Ushbp1	C	T	8: 71,390,713	C314Y	probably damaging	Het
Vav2	A	T	2: 27,299,362		probably benign	Het
Vmn1r228	T	C	17: 20,776,363	M298V	probably benign	Het
Zmpste24	A	T	4: 121,095,543		probably benign	Het

Other mutations in Llgl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00595:Llgl2	APN	11	115834884	missense	probably benign	0.00
IGL01145:Llgl2	APN	11	115853805	missense	probably benign
IGL01344:Llgl2	APN	11	115851193	missense	probably benign	0.01
IGL01980:Llgl2	APN	11	115850025	missense	probably damaging	1.00
IGL02220:Llgl2	APN	11	115845379	missense	possibly damaging	0.64
IGL02341:Llgl2	APN	11	115851120	missense	possibly damaging	0.70
IGL02399:Llgl2	APN	11	115844835	missense	probably damaging	0.97
IGL02415:Llgl2	APN	11	115853285	missense	probably damaging	0.98
IGL02632:Llgl2	APN	11	115844872	missense	probably damaging	1.00
IGL02990:Llgl2	APN	11	115854333	missense	probably benign	0.01
IGL03405:Llgl2	APN	11	115850842	missense	probably benign	0.09
R0166:Llgl2	UTSW	11	115844854	missense	probably damaging	1.00
R0277:Llgl2	UTSW	11	115850720	missense	probably damaging	1.00
R0323:Llgl2	UTSW	11	115850720	missense	probably damaging	1.00
R0345:Llgl2	UTSW	11	115849992	splice site	probably benign
R0614:Llgl2	UTSW	11	115850267	missense	probably damaging	1.00
R0980:Llgl2	UTSW	11	115850001	missense	probably damaging	1.00
R1387:Llgl2	UTSW	11	115853132	missense	probably damaging	0.99
R1456:Llgl2	UTSW	11	115845499	missense	probably benign	0.00
R1541:Llgl2	UTSW	11	115853121	missense	probably benign	0.00
R1832:Llgl2	UTSW	11	115851100	missense	probably damaging	1.00
R1950:Llgl2	UTSW	11	115851066	missense	probably damaging	0.96
R2991:Llgl2	UTSW	11	115851120	missense	probably benign	0.05
R4018:Llgl2	UTSW	11	115847612	missense	probably benign	0.31
R4582:Llgl2	UTSW	11	115850706	missense	possibly damaging	0.89
R4729:Llgl2	UTSW	11	115848299	missense	probably damaging	0.98
R4907:Llgl2	UTSW	11	115853974	nonsense	probably null
R5000:Llgl2	UTSW	11	115844902	missense	probably benign
R5016:Llgl2	UTSW	11	115853424	missense	probably damaging	1.00
R5175:Llgl2	UTSW	11	115850721	missense	probably damaging	1.00
R5857:Llgl2	UTSW	11	115850281	missense	probably damaging	1.00
R6190:Llgl2	UTSW	11	115846986	missense	probably benign	0.00
R6451:Llgl2	UTSW	11	115844941	missense	probably damaging	0.99
R6804:Llgl2	UTSW	11	115843315	critical splice acceptor site	probably null
R6909:Llgl2	UTSW	11	115850799	missense	probably damaging	1.00
R7324:Llgl2	UTSW	11	115850730	missense	possibly damaging	0.49
R7332:Llgl2	UTSW	11	115848299	missense	probably damaging	0.98
R7715:Llgl2	UTSW	11	115849728	missense	probably benign
R8038:Llgl2	UTSW	11	115851103	missense	probably benign	0.17
R8069:Llgl2	UTSW	11	115853286	missense	probably damaging	0.99
R8076:Llgl2	UTSW	11	115846929	missense	possibly damaging	0.69
R8109:Llgl2	UTSW	11	115850793	missense	possibly damaging	0.52
R8129:Llgl2	UTSW	11	115850911	splice site	probably null
X0058:Llgl2	UTSW	11	115850637	missense	probably damaging	0.99
Z1176:Llgl2	UTSW	11	115849554	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGTGAATTGCCTTCCCCAACCC -3'
(R):5'- TTTCAAGGAGCCCCAGGACAAAAG -3'

Sequencing Primer
(F):5'- TCAGATCACTGACTGAGTGC -3'
(R):5'- ACAAAAGGCTCTCTGTGGTTC -3'

Posted On

2013-05-23