Mutagenetix > Incidental Mutations

Incidental Mutation 'R0097:Ncam2'

41175

Institutional Source

Beutler Lab

Gene Symbol

Ncam2

Ensembl Gene

ENSMUSG00000022762

Gene Name

neural cell adhesion molecule 2

Synonyms

Ocam, RNCAM, Ncam-2, R4B12 antigen

MMRRC Submission

038383-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0097 (G1)

Quality Score

160

Status

Validated

Chromosome

Chromosomal Location

81200697-81626828 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 81517537 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 467 (D467G)

Ref Sequence

ENSEMBL: ENSMUSP00000063468 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037785] [ENSMUST00000067602]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037785
AA Change: D467G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000049390
Gene: ENSMUSG00000022762
AA Change: D467G

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
IGc2	33	100	3.18e-6	SMART
IGc2	127	193	1.13e-11	SMART
IGc2	223	288	2.03e-13	SMART
IGc2	313	387	1.12e-15	SMART
IGc2	413	482	9.93e-8	SMART
FN3	496	578	5.91e-13	SMART
FN3	594	675	2.87e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000067602
AA Change: D467G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000063468
Gene: ENSMUSG00000022762
AA Change: D467G

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
IGc2	33	100	3.18e-6	SMART
IGc2	127	193	1.13e-11	SMART
IGc2	223	288	2.03e-13	SMART
IGc2	313	387	1.12e-15	SMART
IGc2	413	482	9.93e-8	SMART
FN3	496	578	5.91e-13	SMART
FN3	594	675	2.87e-2	SMART
transmembrane domain	696	718	N/A	INTRINSIC
low complexity region	741	757	N/A	INTRINSIC
low complexity region	789	812	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232550

Meta Mutation Damage Score

0.2750

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the immunoglobulin superfamily. It is a type I membrane protein and may function in selective fasciculation and zone-to-zone projection of the primary olfactory axons. [provided by RefSeq, Jul 2008]
PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. Mice homozygous for a knock-out allele exhibit exhibit increased proliferation rate and clonogenic frequency in spinal cord-derived neurospheres. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	T	3: 124,412,480	I353K	probably benign	Het
5830473C10Rik	T	A	5: 90,584,936	S535R	probably benign	Het
Arfgap2	T	A	2: 91,274,815	V422E	probably benign	Het
Baz1b	T	C	5: 135,198,259	S105P	probably benign	Het
Bbs10	T	C	10: 111,298,844	V41A	probably damaging	Het
Cacna1s	T	A	1: 136,100,622	M899K	possibly damaging	Het
Ccnd2	G	A	6: 127,146,052	A180V	probably benign	Het
Cldnd1	A	G	16: 58,729,715	N87S	possibly damaging	Het
Cyp2c54	T	A	19: 40,047,658		probably benign	Het
Cyp2c54	G	T	19: 40,047,659		probably benign	Het
Dab2ip	G	A	2: 35,718,916	V629M	possibly damaging	Het
Ddx41	A	T	13: 55,535,878		probably benign	Het
Dmrta1	A	T	4: 89,688,872	R188S	probably benign	Het
Eml3	T	A	19: 8,936,651	F465L	probably benign	Het
Gm13128	T	C	4: 144,331,287	S155P	probably benign	Het
Gm9938	T	A	19: 23,724,464		probably benign	Het
Gpr87	G	A	3: 59,179,085	T333I	probably damaging	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Llgl2	T	A	11: 115,844,497	Y59*	probably null	Het
Lzic	A	G	4: 149,488,076	E41G	probably damaging	Het
Mprip	T	A	11: 59,758,491	L1007Q	possibly damaging	Het
Mtfr2	T	A	10: 20,348,376	S19T	probably damaging	Het
Mycbp2	A	T	14: 103,155,762	M3121K	probably damaging	Het
Myocd	T	A	11: 65,179,014	M667L	possibly damaging	Het
Narfl	T	C	17: 25,777,002	S67P	possibly damaging	Het
Neb	T	C	2: 52,204,894	N4882S	probably damaging	Het
Neu2	A	G	1: 87,597,466	D391G	probably benign	Het
Nol4	C	A	18: 22,719,141	A456S	probably benign	Het
Olfr1025-ps1	T	C	2: 85,918,840	V305A	probably benign	Het
Padi6	C	T	4: 140,730,957	V513M	probably benign	Het
Pign	G	A	1: 105,587,976		probably benign	Het
Plpp2	T	C	10: 79,530,537	E91G	possibly damaging	Het
Pnp	T	A	14: 50,951,416	V222D	probably damaging	Het
Pnp2	C	T	14: 50,963,501	R148C	probably benign	Het
Prss38	A	G	11: 59,375,608	L8S	possibly damaging	Het
Rab5b	A	T	10: 128,682,940	F108I	probably damaging	Het
Rbbp5	T	A	1: 132,490,489	H15Q	possibly damaging	Het
Rhox4f	A	C	X: 37,607,469	V15G	probably benign	Het
Rsl1	A	C	13: 67,181,902	Q138P	probably damaging	Het
Ryr3	T	C	2: 112,800,055	D2157G	probably damaging	Het
Secisbp2l	T	C	2: 125,771,456	D206G	probably damaging	Het
Sh3pxd2b	T	A	11: 32,403,978	I182N	probably damaging	Het
Slc3a1	A	T	17: 85,032,860	I237F	probably damaging	Het
Svs3b	T	C	2: 164,256,239	E54G	probably damaging	Het
T	A	T	17: 8,439,901		probably benign	Het
Tenm4	A	T	7: 96,892,926	D1882V	probably damaging	Het
Tgfbr1	T	A	4: 47,403,451	L283*	probably null	Het
Tppp3	C	T	8: 105,467,922	A149T	probably benign	Het
Ubp1	T	C	9: 113,973,507		probably benign	Het
Ushbp1	C	T	8: 71,390,713	C314Y	probably damaging	Het
Vav2	A	T	2: 27,299,362		probably benign	Het
Vmn1r228	T	C	17: 20,776,363	M298V	probably benign	Het
Zmpste24	A	T	4: 121,095,543		probably benign	Het

Other mutations in Ncam2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01138:Ncam2	APN	16	81517579	missense	probably damaging	1.00
IGL01369:Ncam2	APN	16	81461571	missense	probably benign	0.09
IGL01554:Ncam2	APN	16	81512935	missense	possibly damaging	0.88
IGL01892:Ncam2	APN	16	81589699	missense	possibly damaging	0.71
IGL02320:Ncam2	APN	16	81434837	missense	probably damaging	0.99
IGL02669:Ncam2	APN	16	81517541	missense	probably benign	0.18
IGL03073:Ncam2	APN	16	81621347	missense	possibly damaging	0.70
IGL03353:Ncam2	APN	16	81434900	missense	probably benign	0.04
BB009:Ncam2	UTSW	16	81615820	missense	probably damaging	0.99
BB019:Ncam2	UTSW	16	81615820	missense	probably damaging	0.99
R0087:Ncam2	UTSW	16	81434901	missense	probably benign	0.11
R0276:Ncam2	UTSW	16	81517629	splice site	probably benign
R0279:Ncam2	UTSW	16	81623337	splice site	probably benign
R0471:Ncam2	UTSW	16	81200884	start gained	probably benign
R0523:Ncam2	UTSW	16	81461643	missense	probably damaging	0.99
R1353:Ncam2	UTSW	16	81200915	start codon destroyed	probably null
R1646:Ncam2	UTSW	16	81465706	critical splice donor site	probably benign
R1884:Ncam2	UTSW	16	81437683	missense	probably damaging	1.00
R2002:Ncam2	UTSW	16	81589698	missense	possibly damaging	0.70
R2157:Ncam2	UTSW	16	81490389	missense	probably damaging	1.00
R2330:Ncam2	UTSW	16	81512921	missense	probably benign	0.17
R2404:Ncam2	UTSW	16	81490240	splice site	probably benign
R2434:Ncam2	UTSW	16	81595225	missense	probably benign	0.01
R3104:Ncam2	UTSW	16	81465710	splice site	probably benign
R3842:Ncam2	UTSW	16	81434810	missense	probably damaging	1.00
R3954:Ncam2	UTSW	16	81589724	missense	probably damaging	1.00
R4039:Ncam2	UTSW	16	81490323	missense	probably benign	0.02
R4210:Ncam2	UTSW	16	81527103	missense	probably benign	0.02
R4514:Ncam2	UTSW	16	81512996	missense	probably benign	0.13
R4583:Ncam2	UTSW	16	81517557	missense	probably damaging	1.00
R4586:Ncam2	UTSW	16	81465569	missense	probably benign	0.06
R4710:Ncam2	UTSW	16	81465706	critical splice donor site	probably null
R4732:Ncam2	UTSW	16	81434884	missense	possibly damaging	0.63
R4733:Ncam2	UTSW	16	81434884	missense	possibly damaging	0.63
R4876:Ncam2	UTSW	16	81490346	missense	probably benign	0.27
R4923:Ncam2	UTSW	16	81589791	missense	possibly damaging	0.48
R5131:Ncam2	UTSW	16	81437662	missense	probably benign	0.44
R5329:Ncam2	UTSW	16	81434819	missense	probably damaging	1.00
R5478:Ncam2	UTSW	16	81434878	nonsense	probably null
R5479:Ncam2	UTSW	16	81434878	nonsense	probably null
R5481:Ncam2	UTSW	16	81434878	nonsense	probably null
R5519:Ncam2	UTSW	16	81434878	nonsense	probably null
R5522:Ncam2	UTSW	16	81434878	nonsense	probably null
R5523:Ncam2	UTSW	16	81434878	nonsense	probably null
R5524:Ncam2	UTSW	16	81434878	nonsense	probably null
R5526:Ncam2	UTSW	16	81434878	nonsense	probably null
R5718:Ncam2	UTSW	16	81589814	splice site	probably null
R5793:Ncam2	UTSW	16	81576103	missense	possibly damaging	0.95
R6050:Ncam2	UTSW	16	81443166	nonsense	probably null
R6212:Ncam2	UTSW	16	81432762	missense	probably damaging	1.00
R6847:Ncam2	UTSW	16	81432718	missense	probably damaging	1.00
R6935:Ncam2	UTSW	16	81526991	missense	probably benign	0.24
R7159:Ncam2	UTSW	16	81490374	missense	probably damaging	1.00
R7193:Ncam2	UTSW	16	81589795	missense	probably damaging	1.00
R7232:Ncam2	UTSW	16	81512871	missense	probably damaging	1.00
R7346:Ncam2	UTSW	16	81623368	missense	probably damaging	1.00
R7568:Ncam2	UTSW	16	81589801	missense	probably benign	0.19
R7686:Ncam2	UTSW	16	81621454	missense	probably damaging	0.99
R7759:Ncam2	UTSW	16	81615784	missense	probably damaging	1.00
R7848:Ncam2	UTSW	16	81490379	missense	probably benign
R7932:Ncam2	UTSW	16	81615820	missense	probably damaging	0.99
R8078:Ncam2	UTSW	16	81443248	missense	possibly damaging	0.60
R8287:Ncam2	UTSW	16	81526995	missense	probably benign	0.07
R8354:Ncam2	UTSW	16	81512959	missense	probably benign	0.00
R8429:Ncam2	UTSW	16	81589635	missense	probably damaging	1.00
R8507:Ncam2	UTSW	16	81512979	missense	possibly damaging	0.63
R8546:Ncam2	UTSW	16	81517531	missense	probably benign	0.21

Predicted Primers

PCR Primer
(F):5'- ATGTTTGCATTAATTATGAATGTTGGCTGGAT -3'
(R):5'- TGCACACCTTCTGTCGAAGAAACTC -3'

Sequencing Primer
(F):5'- TTATGAATGTTGGCTGGATAAAGAG -3'
(R):5'- CTGTCGAAGAAACTCAGAACTCTTG -3'

Posted On

2013-05-23