Incidental Mutation 'R0097:Ncam2'
ID41175
Institutional Source Beutler Lab
Gene Symbol Ncam2
Ensembl Gene ENSMUSG00000022762
Gene Nameneural cell adhesion molecule 2
SynonymsOcam, RNCAM, Ncam-2, R4B12 antigen
MMRRC Submission 038383-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0097 (G1)
Quality Score160
Status Validated
Chromosome16
Chromosomal Location81200697-81626828 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81517537 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 467 (D467G)
Ref Sequence ENSEMBL: ENSMUSP00000063468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037785] [ENSMUST00000067602]
Predicted Effect probably damaging
Transcript: ENSMUST00000037785
AA Change: D467G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049390
Gene: ENSMUSG00000022762
AA Change: D467G

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
IGc2 33 100 3.18e-6 SMART
IGc2 127 193 1.13e-11 SMART
IGc2 223 288 2.03e-13 SMART
IGc2 313 387 1.12e-15 SMART
IGc2 413 482 9.93e-8 SMART
FN3 496 578 5.91e-13 SMART
FN3 594 675 2.87e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000067602
AA Change: D467G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063468
Gene: ENSMUSG00000022762
AA Change: D467G

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
IGc2 33 100 3.18e-6 SMART
IGc2 127 193 1.13e-11 SMART
IGc2 223 288 2.03e-13 SMART
IGc2 313 387 1.12e-15 SMART
IGc2 413 482 9.93e-8 SMART
FN3 496 578 5.91e-13 SMART
FN3 594 675 2.87e-2 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 741 757 N/A INTRINSIC
low complexity region 789 812 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232550
Meta Mutation Damage Score 0.2750 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the immunoglobulin superfamily. It is a type I membrane protein and may function in selective fasciculation and zone-to-zone projection of the primary olfactory axons. [provided by RefSeq, Jul 2008]
PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. Mice homozygous for a knock-out allele exhibit exhibit increased proliferation rate and clonogenic frequency in spinal cord-derived neurospheres. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,412,480 I353K probably benign Het
5830473C10Rik T A 5: 90,584,936 S535R probably benign Het
Arfgap2 T A 2: 91,274,815 V422E probably benign Het
Baz1b T C 5: 135,198,259 S105P probably benign Het
Bbs10 T C 10: 111,298,844 V41A probably damaging Het
Cacna1s T A 1: 136,100,622 M899K possibly damaging Het
Ccnd2 G A 6: 127,146,052 A180V probably benign Het
Cldnd1 A G 16: 58,729,715 N87S possibly damaging Het
Cyp2c54 T A 19: 40,047,658 probably benign Het
Cyp2c54 G T 19: 40,047,659 probably benign Het
Dab2ip G A 2: 35,718,916 V629M possibly damaging Het
Ddx41 A T 13: 55,535,878 probably benign Het
Dmrta1 A T 4: 89,688,872 R188S probably benign Het
Eml3 T A 19: 8,936,651 F465L probably benign Het
Gm13128 T C 4: 144,331,287 S155P probably benign Het
Gm9938 T A 19: 23,724,464 probably benign Het
Gpr87 G A 3: 59,179,085 T333I probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Llgl2 T A 11: 115,844,497 Y59* probably null Het
Lzic A G 4: 149,488,076 E41G probably damaging Het
Mprip T A 11: 59,758,491 L1007Q possibly damaging Het
Mtfr2 T A 10: 20,348,376 S19T probably damaging Het
Mycbp2 A T 14: 103,155,762 M3121K probably damaging Het
Myocd T A 11: 65,179,014 M667L possibly damaging Het
Narfl T C 17: 25,777,002 S67P possibly damaging Het
Neb T C 2: 52,204,894 N4882S probably damaging Het
Neu2 A G 1: 87,597,466 D391G probably benign Het
Nol4 C A 18: 22,719,141 A456S probably benign Het
Olfr1025-ps1 T C 2: 85,918,840 V305A probably benign Het
Padi6 C T 4: 140,730,957 V513M probably benign Het
Pign G A 1: 105,587,976 probably benign Het
Plpp2 T C 10: 79,530,537 E91G possibly damaging Het
Pnp T A 14: 50,951,416 V222D probably damaging Het
Pnp2 C T 14: 50,963,501 R148C probably benign Het
Prss38 A G 11: 59,375,608 L8S possibly damaging Het
Rab5b A T 10: 128,682,940 F108I probably damaging Het
Rbbp5 T A 1: 132,490,489 H15Q possibly damaging Het
Rhox4f A C X: 37,607,469 V15G probably benign Het
Rsl1 A C 13: 67,181,902 Q138P probably damaging Het
Ryr3 T C 2: 112,800,055 D2157G probably damaging Het
Secisbp2l T C 2: 125,771,456 D206G probably damaging Het
Sh3pxd2b T A 11: 32,403,978 I182N probably damaging Het
Slc3a1 A T 17: 85,032,860 I237F probably damaging Het
Svs3b T C 2: 164,256,239 E54G probably damaging Het
T A T 17: 8,439,901 probably benign Het
Tenm4 A T 7: 96,892,926 D1882V probably damaging Het
Tgfbr1 T A 4: 47,403,451 L283* probably null Het
Tppp3 C T 8: 105,467,922 A149T probably benign Het
Ubp1 T C 9: 113,973,507 probably benign Het
Ushbp1 C T 8: 71,390,713 C314Y probably damaging Het
Vav2 A T 2: 27,299,362 probably benign Het
Vmn1r228 T C 17: 20,776,363 M298V probably benign Het
Zmpste24 A T 4: 121,095,543 probably benign Het
Other mutations in Ncam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Ncam2 APN 16 81517579 missense probably damaging 1.00
IGL01369:Ncam2 APN 16 81461571 missense probably benign 0.09
IGL01554:Ncam2 APN 16 81512935 missense possibly damaging 0.88
IGL01892:Ncam2 APN 16 81589699 missense possibly damaging 0.71
IGL02320:Ncam2 APN 16 81434837 missense probably damaging 0.99
IGL02669:Ncam2 APN 16 81517541 missense probably benign 0.18
IGL03073:Ncam2 APN 16 81621347 missense possibly damaging 0.70
IGL03353:Ncam2 APN 16 81434900 missense probably benign 0.04
BB009:Ncam2 UTSW 16 81615820 missense probably damaging 0.99
BB019:Ncam2 UTSW 16 81615820 missense probably damaging 0.99
R0087:Ncam2 UTSW 16 81434901 missense probably benign 0.11
R0276:Ncam2 UTSW 16 81517629 splice site probably benign
R0279:Ncam2 UTSW 16 81623337 splice site probably benign
R0471:Ncam2 UTSW 16 81200884 start gained probably benign
R0523:Ncam2 UTSW 16 81461643 missense probably damaging 0.99
R1353:Ncam2 UTSW 16 81200915 start codon destroyed probably null
R1646:Ncam2 UTSW 16 81465706 critical splice donor site probably benign
R1884:Ncam2 UTSW 16 81437683 missense probably damaging 1.00
R2002:Ncam2 UTSW 16 81589698 missense possibly damaging 0.70
R2157:Ncam2 UTSW 16 81490389 missense probably damaging 1.00
R2330:Ncam2 UTSW 16 81512921 missense probably benign 0.17
R2404:Ncam2 UTSW 16 81490240 splice site probably benign
R2434:Ncam2 UTSW 16 81595225 missense probably benign 0.01
R3104:Ncam2 UTSW 16 81465710 splice site probably benign
R3842:Ncam2 UTSW 16 81434810 missense probably damaging 1.00
R3954:Ncam2 UTSW 16 81589724 missense probably damaging 1.00
R4039:Ncam2 UTSW 16 81490323 missense probably benign 0.02
R4210:Ncam2 UTSW 16 81527103 missense probably benign 0.02
R4514:Ncam2 UTSW 16 81512996 missense probably benign 0.13
R4583:Ncam2 UTSW 16 81517557 missense probably damaging 1.00
R4586:Ncam2 UTSW 16 81465569 missense probably benign 0.06
R4710:Ncam2 UTSW 16 81465706 critical splice donor site probably null
R4732:Ncam2 UTSW 16 81434884 missense possibly damaging 0.63
R4733:Ncam2 UTSW 16 81434884 missense possibly damaging 0.63
R4876:Ncam2 UTSW 16 81490346 missense probably benign 0.27
R4923:Ncam2 UTSW 16 81589791 missense possibly damaging 0.48
R5131:Ncam2 UTSW 16 81437662 missense probably benign 0.44
R5329:Ncam2 UTSW 16 81434819 missense probably damaging 1.00
R5478:Ncam2 UTSW 16 81434878 nonsense probably null
R5479:Ncam2 UTSW 16 81434878 nonsense probably null
R5481:Ncam2 UTSW 16 81434878 nonsense probably null
R5519:Ncam2 UTSW 16 81434878 nonsense probably null
R5522:Ncam2 UTSW 16 81434878 nonsense probably null
R5523:Ncam2 UTSW 16 81434878 nonsense probably null
R5524:Ncam2 UTSW 16 81434878 nonsense probably null
R5526:Ncam2 UTSW 16 81434878 nonsense probably null
R5718:Ncam2 UTSW 16 81589814 splice site probably null
R5793:Ncam2 UTSW 16 81576103 missense possibly damaging 0.95
R6050:Ncam2 UTSW 16 81443166 nonsense probably null
R6212:Ncam2 UTSW 16 81432762 missense probably damaging 1.00
R6847:Ncam2 UTSW 16 81432718 missense probably damaging 1.00
R6935:Ncam2 UTSW 16 81526991 missense probably benign 0.24
R7159:Ncam2 UTSW 16 81490374 missense probably damaging 1.00
R7193:Ncam2 UTSW 16 81589795 missense probably damaging 1.00
R7232:Ncam2 UTSW 16 81512871 missense probably damaging 1.00
R7346:Ncam2 UTSW 16 81623368 missense probably damaging 1.00
R7568:Ncam2 UTSW 16 81589801 missense probably benign 0.19
R7686:Ncam2 UTSW 16 81621454 missense probably damaging 0.99
R7759:Ncam2 UTSW 16 81615784 missense probably damaging 1.00
R7848:Ncam2 UTSW 16 81490379 missense probably benign
R7932:Ncam2 UTSW 16 81615820 missense probably damaging 0.99
R8078:Ncam2 UTSW 16 81443248 missense possibly damaging 0.60
R8287:Ncam2 UTSW 16 81526995 missense probably benign 0.07
R8354:Ncam2 UTSW 16 81512959 missense probably benign 0.00
R8429:Ncam2 UTSW 16 81589635 missense probably damaging 1.00
R8507:Ncam2 UTSW 16 81512979 missense possibly damaging 0.63
R8546:Ncam2 UTSW 16 81517531 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- ATGTTTGCATTAATTATGAATGTTGGCTGGAT -3'
(R):5'- TGCACACCTTCTGTCGAAGAAACTC -3'

Sequencing Primer
(F):5'- TTATGAATGTTGGCTGGATAAAGAG -3'
(R):5'- CTGTCGAAGAAACTCAGAACTCTTG -3'
Posted On2013-05-23