Incidental Mutation 'R0457:Olfr347'
ID41191
Institutional Source Beutler Lab
Gene Symbol Olfr347
Ensembl Gene ENSMUSG00000111863
Gene Nameolfactory receptor 347
SynonymsGA_x6K02T2NLDC-33428755-33429693, MOR136-9
MMRRC Submission 038657-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R0457 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location36731902-36737640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36734533 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 71 (I71F)
Ref Sequence ENSEMBL: ENSMUSP00000151158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078761] [ENSMUST00000216882]
Predicted Effect probably benign
Transcript: ENSMUST00000078761
AA Change: I71F

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000077819
Gene: ENSMUSG00000111863
AA Change: I71F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.2e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.3e-5 PFAM
Pfam:7tm_1 41 290 1.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216882
AA Change: I71F

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 T C 16: 35,274,545 S691P probably benign Het
Aspscr1 A G 11: 120,677,618 E12G probably benign Het
Atp2a2 T C 5: 122,469,714 Q244R probably benign Het
Birc6 A G 17: 74,652,028 M3818V probably benign Het
Birc6 C T 17: 74,662,625 A4230V probably damaging Het
Bub1b T C 2: 118,609,859 F148S probably damaging Het
C130079G13Rik A G 3: 59,936,633 I249M possibly damaging Het
C1ra T C 6: 124,522,753 S633P probably benign Het
Cacna2d1 A G 5: 16,267,416 T274A probably damaging Het
Cmya5 A G 13: 93,095,587 W998R possibly damaging Het
Crbn T C 6: 106,781,057 K404R probably benign Het
Cryga T C 1: 65,103,045 Y63C probably damaging Het
Csmd1 C A 8: 16,501,393 probably null Het
Defa-ps1 A T 8: 21,695,742 noncoding transcript Het
Dnajc10 T A 2: 80,344,946 V559D possibly damaging Het
Dock1 A T 7: 135,138,145 E1423D possibly damaging Het
Dpf3 A T 12: 83,272,405 S44T probably damaging Het
Dyrk3 A T 1: 131,136,357 V31D possibly damaging Het
F5 T C 1: 164,194,200 S1415P probably benign Het
Fam186b A C 15: 99,271,285 I927S probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fer1l6 G A 15: 58,638,094 probably null Het
Fndc7 G T 3: 108,876,545 S249R probably benign Het
Ganab A G 19: 8,907,250 E139G possibly damaging Het
Gbp5 A G 3: 142,507,757 D478G probably damaging Het
Gm17324 T A 9: 78,448,298 M1K probably null Het
Gm996 G T 2: 25,578,346 R518S possibly damaging Het
Gtpbp6 T A 5: 110,106,742 R126S probably damaging Het
Hapln4 G A 8: 70,088,472 W385* probably null Het
Hmcn2 T A 2: 31,415,284 probably null Het
Hsp90ab1 A G 17: 45,568,988 V534A probably damaging Het
Kat6b C A 14: 21,670,530 T1650K probably damaging Het
Kpna1 T A 16: 36,002,905 D42E probably benign Het
Lrrc14b A G 13: 74,361,160 M376T probably benign Het
Lrrc40 A G 3: 158,054,564 probably null Het
Ltv1 T C 10: 13,192,143 T34A probably benign Het
Mga T A 2: 119,916,488 N373K probably damaging Het
Msh3 A T 13: 92,220,997 M101K probably damaging Het
Mthfd2l T C 5: 91,020,206 M320T possibly damaging Het
Mug1 G A 6: 121,861,555 E506K probably benign Het
Ngb T C 12: 87,100,729 D54G probably damaging Het
Ntrk1 A G 3: 87,791,707 F84L probably benign Het
Olfr667 T A 7: 104,916,973 T108S probably benign Het
Phf12 T A 11: 78,018,168 I358N possibly damaging Het
Plec A G 15: 76,177,601 F2577S probably damaging Het
Polr1c T A 17: 46,247,763 Y36F probably benign Het
Prkd1 A T 12: 50,366,372 M672K probably damaging Het
Prob1 T C 18: 35,652,486 Y905C probably damaging Het
Ptpn23 T A 9: 110,386,293 H1433L possibly damaging Het
Rnf11 A T 4: 109,456,952 L80Q probably damaging Het
Sbp G A 17: 23,945,312 G183D probably benign Het
Scgb2b7 A T 7: 31,704,012 C90S possibly damaging Het
Slc4a9 T C 18: 36,535,418 L710P probably damaging Het
Spire1 T A 18: 67,552,600 I35F probably damaging Het
Sptbn2 T C 19: 4,745,938 V1715A possibly damaging Het
St7 T C 6: 17,819,282 F62L probably damaging Het
Svep1 C T 4: 58,118,136 G862D probably damaging Het
Syne1 A T 10: 5,022,041 M8789K probably damaging Het
Synpo2 A G 3: 123,112,772 L965P probably damaging Het
Trhde A T 10: 114,448,262 M772K probably benign Het
Ttn T A 2: 76,778,507 K15976* probably null Het
Unc13a A C 8: 71,658,001 probably null Het
Vcan T C 13: 89,703,199 E1214G possibly damaging Het
Vmn1r29 T C 6: 58,308,087 V264A probably benign Het
Vmn1r60 T A 7: 5,545,119 probably benign Het
Wdr90 C T 17: 25,860,485 R225H probably benign Het
Wnk1 G A 6: 119,969,332 T620I probably damaging Het
Zan C T 5: 137,407,706 probably benign Het
Zfp37 A T 4: 62,191,665 C387* probably null Het
Zfp521 T C 18: 13,844,840 T839A probably benign Het
Other mutations in Olfr347
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02190:Olfr347 APN 2 36734579 missense probably benign 0.03
IGL02417:Olfr347 APN 2 36734344 missense probably benign 0.13
IGL02488:Olfr347 APN 2 36734350 missense probably benign 0.36
IGL02878:Olfr347 APN 2 36734477 missense probably damaging 1.00
IGL03354:Olfr347 APN 2 36734512 missense possibly damaging 0.87
IGL03354:Olfr347 APN 2 36734513 missense possibly damaging 0.89
PIT4403001:Olfr347 UTSW 2 36734918 missense probably damaging 0.99
R0091:Olfr347 UTSW 2 36734905 missense probably damaging 1.00
R0107:Olfr347 UTSW 2 36734718 nonsense probably null
R0563:Olfr347 UTSW 2 36735001 nonsense probably null
R1205:Olfr347 UTSW 2 36734755 missense probably benign 0.16
R1599:Olfr347 UTSW 2 36734989 missense probably benign 0.01
R1668:Olfr347 UTSW 2 36735192 nonsense probably null
R1845:Olfr347 UTSW 2 36734842 missense probably damaging 0.99
R1856:Olfr347 UTSW 2 36734345 missense probably benign
R2165:Olfr347 UTSW 2 36734701 missense probably damaging 0.97
R4399:Olfr347 UTSW 2 36735230 missense probably benign 0.00
R4657:Olfr347 UTSW 2 36734403 nonsense probably null
R4684:Olfr347 UTSW 2 36734674 missense probably damaging 1.00
R4767:Olfr347 UTSW 2 36734323 start codon destroyed probably benign 0.02
R4988:Olfr347 UTSW 2 36734984 missense possibly damaging 0.94
R5058:Olfr347 UTSW 2 36734999 missense possibly damaging 0.52
R5103:Olfr347 UTSW 2 36734668 missense probably benign 0.23
R5140:Olfr347 UTSW 2 36734498 missense possibly damaging 0.59
R5587:Olfr347 UTSW 2 36734621 missense probably damaging 1.00
R5591:Olfr347 UTSW 2 36735232 missense probably benign
R6738:Olfr347 UTSW 2 36734432 missense probably benign 0.26
R7097:Olfr347 UTSW 2 36734424 missense probably benign 0.02
R7122:Olfr347 UTSW 2 36734424 missense probably benign 0.02
R7330:Olfr347 UTSW 2 36735045 nonsense probably null
R7485:Olfr347 UTSW 2 36734638 missense probably benign 0.01
R7792:Olfr347 UTSW 2 36734330 missense probably benign 0.01
R7812:Olfr347 UTSW 2 36734725 missense probably benign
R8303:Olfr347 UTSW 2 36734455 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAGAGGACCAAGACCTGTATTC -3'
(R):5'- CTGGACAGCTTCAGCAAGGTAGAC -3'

Sequencing Primer
(F):5'- AAGACCTGTATTCTGCCTTGTTC -3'
(R):5'- CACAGAGGTTCTGACTCATCATTG -3'
Posted On2013-05-23