Incidental Mutation 'R0457:Olfr667'
ID41222
Institutional Source Beutler Lab
Gene Symbol Olfr667
Ensembl Gene ENSMUSG00000056782
Gene Nameolfactory receptor 667
SynonymsGA_x6K02T2PBJ9-7546146-7545166, MOR34-2, MOR34-11
MMRRC Submission 038657-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.594) question?
Stock #R0457 (G1)
Quality Score221
Status Not validated
Chromosome7
Chromosomal Location104914742-104921482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104916973 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 108 (T108S)
Ref Sequence ENSEMBL: ENSMUSP00000150340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071362] [ENSMUST00000217177]
Predicted Effect probably benign
Transcript: ENSMUST00000071362
AA Change: T108S

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000100470
Gene: ENSMUSG00000056782
AA Change: T108S

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 4.9e-102 PFAM
Pfam:7TM_GPCR_Srsx 37 310 1.2e-8 PFAM
Pfam:7tm_1 43 295 1.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211111
Predicted Effect probably benign
Transcript: ENSMUST00000217177
AA Change: T108S

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 T C 16: 35,274,545 S691P probably benign Het
Aspscr1 A G 11: 120,677,618 E12G probably benign Het
Atp2a2 T C 5: 122,469,714 Q244R probably benign Het
Birc6 A G 17: 74,652,028 M3818V probably benign Het
Birc6 C T 17: 74,662,625 A4230V probably damaging Het
Bub1b T C 2: 118,609,859 F148S probably damaging Het
C130079G13Rik A G 3: 59,936,633 I249M possibly damaging Het
C1ra T C 6: 124,522,753 S633P probably benign Het
Cacna2d1 A G 5: 16,267,416 T274A probably damaging Het
Cmya5 A G 13: 93,095,587 W998R possibly damaging Het
Crbn T C 6: 106,781,057 K404R probably benign Het
Cryga T C 1: 65,103,045 Y63C probably damaging Het
Csmd1 C A 8: 16,501,393 probably null Het
Defa-ps1 A T 8: 21,695,742 noncoding transcript Het
Dnajc10 T A 2: 80,344,946 V559D possibly damaging Het
Dock1 A T 7: 135,138,145 E1423D possibly damaging Het
Dpf3 A T 12: 83,272,405 S44T probably damaging Het
Dyrk3 A T 1: 131,136,357 V31D possibly damaging Het
F5 T C 1: 164,194,200 S1415P probably benign Het
Fam186b A C 15: 99,271,285 I927S probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fer1l6 G A 15: 58,638,094 probably null Het
Fndc7 G T 3: 108,876,545 S249R probably benign Het
Ganab A G 19: 8,907,250 E139G possibly damaging Het
Gbp5 A G 3: 142,507,757 D478G probably damaging Het
Gm17324 T A 9: 78,448,298 M1K probably null Het
Gm996 G T 2: 25,578,346 R518S possibly damaging Het
Gtpbp6 T A 5: 110,106,742 R126S probably damaging Het
Hapln4 G A 8: 70,088,472 W385* probably null Het
Hmcn2 T A 2: 31,415,284 probably null Het
Hsp90ab1 A G 17: 45,568,988 V534A probably damaging Het
Kat6b C A 14: 21,670,530 T1650K probably damaging Het
Kpna1 T A 16: 36,002,905 D42E probably benign Het
Lrrc14b A G 13: 74,361,160 M376T probably benign Het
Lrrc40 A G 3: 158,054,564 probably null Het
Ltv1 T C 10: 13,192,143 T34A probably benign Het
Mga T A 2: 119,916,488 N373K probably damaging Het
Msh3 A T 13: 92,220,997 M101K probably damaging Het
Mthfd2l T C 5: 91,020,206 M320T possibly damaging Het
Mug1 G A 6: 121,861,555 E506K probably benign Het
Ngb T C 12: 87,100,729 D54G probably damaging Het
Ntrk1 A G 3: 87,791,707 F84L probably benign Het
Olfr347 A T 2: 36,734,533 I71F probably benign Het
Phf12 T A 11: 78,018,168 I358N possibly damaging Het
Plec A G 15: 76,177,601 F2577S probably damaging Het
Polr1c T A 17: 46,247,763 Y36F probably benign Het
Prkd1 A T 12: 50,366,372 M672K probably damaging Het
Prob1 T C 18: 35,652,486 Y905C probably damaging Het
Ptpn23 T A 9: 110,386,293 H1433L possibly damaging Het
Rnf11 A T 4: 109,456,952 L80Q probably damaging Het
Sbp G A 17: 23,945,312 G183D probably benign Het
Scgb2b7 A T 7: 31,704,012 C90S possibly damaging Het
Slc4a9 T C 18: 36,535,418 L710P probably damaging Het
Spire1 T A 18: 67,552,600 I35F probably damaging Het
Sptbn2 T C 19: 4,745,938 V1715A possibly damaging Het
St7 T C 6: 17,819,282 F62L probably damaging Het
Svep1 C T 4: 58,118,136 G862D probably damaging Het
Syne1 A T 10: 5,022,041 M8789K probably damaging Het
Synpo2 A G 3: 123,112,772 L965P probably damaging Het
Trhde A T 10: 114,448,262 M772K probably benign Het
Ttn T A 2: 76,778,507 K15976* probably null Het
Unc13a A C 8: 71,658,001 probably null Het
Vcan T C 13: 89,703,199 E1214G possibly damaging Het
Vmn1r29 T C 6: 58,308,087 V264A probably benign Het
Vmn1r60 T A 7: 5,545,119 probably benign Het
Wdr90 C T 17: 25,860,485 R225H probably benign Het
Wnk1 G A 6: 119,969,332 T620I probably damaging Het
Zan C T 5: 137,407,706 probably benign Het
Zfp37 A T 4: 62,191,665 C387* probably null Het
Zfp521 T C 18: 13,844,840 T839A probably benign Het
Other mutations in Olfr667
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02707:Olfr667 APN 7 104916652 missense probably damaging 1.00
R0684:Olfr667 UTSW 7 104916634 missense probably benign 0.21
R1343:Olfr667 UTSW 7 104916627 missense probably damaging 1.00
R1401:Olfr667 UTSW 7 104916756 missense probably damaging 1.00
R1415:Olfr667 UTSW 7 104916336 missense probably benign 0.03
R1644:Olfr667 UTSW 7 104916808 missense probably benign 0.02
R1907:Olfr667 UTSW 7 104917065 missense probably damaging 0.99
R2063:Olfr667 UTSW 7 104916775 missense probably benign 0.02
R3774:Olfr667 UTSW 7 104916906 missense probably benign 0.01
R4751:Olfr667 UTSW 7 104916410 nonsense probably null
R4958:Olfr667 UTSW 7 104916461 missense probably damaging 0.97
R4960:Olfr667 UTSW 7 104916708 missense probably benign 0.02
R5362:Olfr667 UTSW 7 104916627 missense probably damaging 1.00
R5988:Olfr667 UTSW 7 104916918 missense probably damaging 0.98
R7396:Olfr667 UTSW 7 104916351 missense probably benign
R8169:Olfr667 UTSW 7 104916412 missense possibly damaging 0.60
R8517:Olfr667 UTSW 7 104916474 missense possibly damaging 0.80
Z1088:Olfr667 UTSW 7 104916666 missense probably benign 0.06
Z1177:Olfr667 UTSW 7 104917119 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AAGGATGAATGCCACACTCCTCAAG -3'
(R):5'- TGCCAGCCAATATGTCTGAAGCC -3'

Sequencing Primer
(F):5'- TCAAGAAAGTAGCAAGACTAGCTTTG -3'
(R):5'- GAAGATGCACATGTCTGGATCTC -3'
Posted On2013-05-23