Incidental Mutation 'R0457:Aspscr1'
ID41238
Institutional Source Beutler Lab
Gene Symbol Aspscr1
Ensembl Gene ENSMUSG00000025142
Gene Namealveolar soft part sarcoma chromosome region, candidate 1 (human)
SynonymsASPCR1, RCC17, TUG, ASPC, ASPL, 1190006K01Rik
MMRRC Submission 038657-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0457 (G1)
Quality Score208
Status Not validated
Chromosome11
Chromosomal Location120672973-120709447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120677618 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 12 (E12G)
Ref Sequence ENSEMBL: ENSMUSP00000123650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026135] [ENSMUST00000103016] [ENSMUST00000106158] [ENSMUST00000106159] [ENSMUST00000106160] [ENSMUST00000127269] [ENSMUST00000129644] [ENSMUST00000131727] [ENSMUST00000135346] [ENSMUST00000143844] [ENSMUST00000149389] [ENSMUST00000151160] [ENSMUST00000153346] [ENSMUST00000168097] [ENSMUST00000168714]
Predicted Effect probably benign
Transcript: ENSMUST00000026135
AA Change: E89G

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000026135
Gene: ENSMUSG00000025142
AA Change: E89G

DomainStartEndE-ValueType
Pfam:TUG-UBL1 15 78 1.4e-29 PFAM
low complexity region 193 206 N/A INTRINSIC
low complexity region 284 313 N/A INTRINSIC
coiled coil region 339 365 N/A INTRINSIC
UBX 378 459 1.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103016
AA Change: E12G

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099305
Gene: ENSMUSG00000025142
AA Change: E12G

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
UBX 301 382 1.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106158
AA Change: E12G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000101764
Gene: ENSMUSG00000025142
AA Change: E12G

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
Blast:UBX 301 361 2e-29 BLAST
SCOP:d1h8ca_ 308 364 2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106159
AA Change: E12G

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000101765
Gene: ENSMUSG00000025142
AA Change: E12G

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
UBX 301 382 1.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106160
AA Change: E12G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000101766
Gene: ENSMUSG00000025142
AA Change: E12G

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
Blast:UBX 301 361 2e-29 BLAST
SCOP:d1h8ca_ 308 364 2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127269
AA Change: E12G

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000129644
AA Change: E12G

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000131727
AA Change: E12G

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117654
Gene: ENSMUSG00000025142
AA Change: E12G

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135346
AA Change: E12G

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000120072
Gene: ENSMUSG00000025142
AA Change: E12G

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143844
AA Change: E12G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000149389
AA Change: E74G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000122216
Gene: ENSMUSG00000025142
AA Change: E74G

DomainStartEndE-ValueType
Pfam:TUG-UBL1 3 63 3.7e-24 PFAM
low complexity region 178 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151160
AA Change: E12G

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000116447
Gene: ENSMUSG00000025142
AA Change: E12G

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153346
AA Change: E12G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000168097
AA Change: E12G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000168714
AA Change: E12G

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000129462
Gene: ENSMUSG00000025142
AA Change: E12G

DomainStartEndE-ValueType
SCOP:d1h8ca_ 12 82 2e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171700
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a UBX domain and interacts with glucose transporter type 4 (GLUT4). This protein is a tether, which sequesters the GLUT4 in intracellular vesicles in muscle and fat cells in the absence of insulin, and redistributes the GLUT4 to the plasma membrane within minutes of insulin stimulation. Translocation t(X;17)(p11;q25) of this gene with transcription factor TFE3 gene results in a ASPSCR1-TFE3 fusion protein in alveolar soft part sarcoma and in renal cell carcinomas. Multiple alternatively spliced transcript variants have been found. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 T C 16: 35,274,545 S691P probably benign Het
Atp2a2 T C 5: 122,469,714 Q244R probably benign Het
Birc6 A G 17: 74,652,028 M3818V probably benign Het
Birc6 C T 17: 74,662,625 A4230V probably damaging Het
Bub1b T C 2: 118,609,859 F148S probably damaging Het
C130079G13Rik A G 3: 59,936,633 I249M possibly damaging Het
C1ra T C 6: 124,522,753 S633P probably benign Het
Cacna2d1 A G 5: 16,267,416 T274A probably damaging Het
Cmya5 A G 13: 93,095,587 W998R possibly damaging Het
Crbn T C 6: 106,781,057 K404R probably benign Het
Cryga T C 1: 65,103,045 Y63C probably damaging Het
Csmd1 C A 8: 16,501,393 probably null Het
Defa-ps1 A T 8: 21,695,742 noncoding transcript Het
Dnajc10 T A 2: 80,344,946 V559D possibly damaging Het
Dock1 A T 7: 135,138,145 E1423D possibly damaging Het
Dpf3 A T 12: 83,272,405 S44T probably damaging Het
Dyrk3 A T 1: 131,136,357 V31D possibly damaging Het
F5 T C 1: 164,194,200 S1415P probably benign Het
Fam186b A C 15: 99,271,285 I927S probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fer1l6 G A 15: 58,638,094 probably null Het
Fndc7 G T 3: 108,876,545 S249R probably benign Het
Ganab A G 19: 8,907,250 E139G possibly damaging Het
Gbp5 A G 3: 142,507,757 D478G probably damaging Het
Gm17324 T A 9: 78,448,298 M1K probably null Het
Gm996 G T 2: 25,578,346 R518S possibly damaging Het
Gtpbp6 T A 5: 110,106,742 R126S probably damaging Het
Hapln4 G A 8: 70,088,472 W385* probably null Het
Hmcn2 T A 2: 31,415,284 probably null Het
Hsp90ab1 A G 17: 45,568,988 V534A probably damaging Het
Kat6b C A 14: 21,670,530 T1650K probably damaging Het
Kpna1 T A 16: 36,002,905 D42E probably benign Het
Lrrc14b A G 13: 74,361,160 M376T probably benign Het
Lrrc40 A G 3: 158,054,564 probably null Het
Ltv1 T C 10: 13,192,143 T34A probably benign Het
Mga T A 2: 119,916,488 N373K probably damaging Het
Msh3 A T 13: 92,220,997 M101K probably damaging Het
Mthfd2l T C 5: 91,020,206 M320T possibly damaging Het
Mug1 G A 6: 121,861,555 E506K probably benign Het
Ngb T C 12: 87,100,729 D54G probably damaging Het
Ntrk1 A G 3: 87,791,707 F84L probably benign Het
Olfr347 A T 2: 36,734,533 I71F probably benign Het
Olfr667 T A 7: 104,916,973 T108S probably benign Het
Phf12 T A 11: 78,018,168 I358N possibly damaging Het
Plec A G 15: 76,177,601 F2577S probably damaging Het
Polr1c T A 17: 46,247,763 Y36F probably benign Het
Prkd1 A T 12: 50,366,372 M672K probably damaging Het
Prob1 T C 18: 35,652,486 Y905C probably damaging Het
Ptpn23 T A 9: 110,386,293 H1433L possibly damaging Het
Rnf11 A T 4: 109,456,952 L80Q probably damaging Het
Sbp G A 17: 23,945,312 G183D probably benign Het
Scgb2b7 A T 7: 31,704,012 C90S possibly damaging Het
Slc4a9 T C 18: 36,535,418 L710P probably damaging Het
Spire1 T A 18: 67,552,600 I35F probably damaging Het
Sptbn2 T C 19: 4,745,938 V1715A possibly damaging Het
St7 T C 6: 17,819,282 F62L probably damaging Het
Svep1 C T 4: 58,118,136 G862D probably damaging Het
Syne1 A T 10: 5,022,041 M8789K probably damaging Het
Synpo2 A G 3: 123,112,772 L965P probably damaging Het
Trhde A T 10: 114,448,262 M772K probably benign Het
Ttn T A 2: 76,778,507 K15976* probably null Het
Unc13a A C 8: 71,658,001 probably null Het
Vcan T C 13: 89,703,199 E1214G possibly damaging Het
Vmn1r29 T C 6: 58,308,087 V264A probably benign Het
Vmn1r60 T A 7: 5,545,119 probably benign Het
Wdr90 C T 17: 25,860,485 R225H probably benign Het
Wnk1 G A 6: 119,969,332 T620I probably damaging Het
Zan C T 5: 137,407,706 probably benign Het
Zfp37 A T 4: 62,191,665 C387* probably null Het
Zfp521 T C 18: 13,844,840 T839A probably benign Het
Other mutations in Aspscr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02588:Aspscr1 APN 11 120677531 missense possibly damaging 0.93
IGL02683:Aspscr1 APN 11 120701226 missense probably damaging 1.00
IGL02719:Aspscr1 APN 11 120677579 missense probably damaging 1.00
I1329:Aspscr1 UTSW 11 120701240 missense probably damaging 0.99
R0113:Aspscr1 UTSW 11 120688925 missense probably damaging 1.00
R0277:Aspscr1 UTSW 11 120678420 missense probably damaging 1.00
R0323:Aspscr1 UTSW 11 120678420 missense probably damaging 1.00
R0714:Aspscr1 UTSW 11 120703667 critical splice donor site probably null
R1435:Aspscr1 UTSW 11 120689222 missense probably benign 0.00
R1509:Aspscr1 UTSW 11 120701516 missense probably damaging 1.00
R1739:Aspscr1 UTSW 11 120678516 missense probably damaging 1.00
R1789:Aspscr1 UTSW 11 120688560 missense probably damaging 1.00
R1958:Aspscr1 UTSW 11 120689208 missense probably null 1.00
R2414:Aspscr1 UTSW 11 120689222 missense probably benign 0.00
R2432:Aspscr1 UTSW 11 120702566 intron probably benign
R4059:Aspscr1 UTSW 11 120686679 missense probably benign 0.22
R4159:Aspscr1 UTSW 11 120708676 missense probably damaging 1.00
R4703:Aspscr1 UTSW 11 120688945 missense possibly damaging 0.87
R4705:Aspscr1 UTSW 11 120688945 missense possibly damaging 0.87
R4748:Aspscr1 UTSW 11 120701507 missense probably damaging 0.99
R5141:Aspscr1 UTSW 11 120689177 missense probably benign 0.01
R5869:Aspscr1 UTSW 11 120688920 missense possibly damaging 0.55
R7543:Aspscr1 UTSW 11 120709423 missense unknown
R7555:Aspscr1 UTSW 11 120673100 missense unknown
R7609:Aspscr1 UTSW 11 120677522 missense probably damaging 0.99
R7670:Aspscr1 UTSW 11 120689039 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCAGCCCTGTGCCTATCTAAAG -3'
(R):5'- AGGACTAGCTTCAACCTCTCCAGC -3'

Sequencing Primer
(F):5'- ATCTAAAGCTCCTGTTAGTCCAG -3'
(R):5'- CAGCCCTTCTCAGGCCC -3'
Posted On2013-05-23