Incidental Mutation 'R0457:Prkd1'
ID41240
Institutional Source Beutler Lab
Gene Symbol Prkd1
Ensembl Gene ENSMUSG00000002688
Gene Nameprotein kinase D1
SynonymsPrkcm, Pkcm, PKD1
MMRRC Submission 038657-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0457 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location50341231-50649098 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50366372 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 672 (M672K)
Ref Sequence ENSEMBL: ENSMUSP00000002765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002765]
Predicted Effect probably damaging
Transcript: ENSMUST00000002765
AA Change: M672K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002765
Gene: ENSMUSG00000002688
AA Change: M672K

DomainStartEndE-ValueType
low complexity region 2 46 N/A INTRINSIC
C1 138 194 1.36e-12 SMART
C1 277 326 5.95e-18 SMART
PH 429 549 5.33e-9 SMART
S_TKc 589 845 1.24e-92 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase involved in many cellular processes, including Golgi body membrane integrity and transport, cell migration and differentiation, MAPK8/JNK1 and Ras pathway signaling, MAPK1/3 (ERK1/2) pathway signaling, cell survival, and regulation of cell shape and adhesion. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial embryonic lethality. Mice homozygous for a knock-in allele display partial embryonic and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 T C 16: 35,274,545 S691P probably benign Het
Aspscr1 A G 11: 120,677,618 E12G probably benign Het
Atp2a2 T C 5: 122,469,714 Q244R probably benign Het
Birc6 A G 17: 74,652,028 M3818V probably benign Het
Birc6 C T 17: 74,662,625 A4230V probably damaging Het
Bub1b T C 2: 118,609,859 F148S probably damaging Het
C130079G13Rik A G 3: 59,936,633 I249M possibly damaging Het
C1ra T C 6: 124,522,753 S633P probably benign Het
Cacna2d1 A G 5: 16,267,416 T274A probably damaging Het
Cmya5 A G 13: 93,095,587 W998R possibly damaging Het
Crbn T C 6: 106,781,057 K404R probably benign Het
Cryga T C 1: 65,103,045 Y63C probably damaging Het
Csmd1 C A 8: 16,501,393 probably null Het
Defa-ps1 A T 8: 21,695,742 noncoding transcript Het
Dnajc10 T A 2: 80,344,946 V559D possibly damaging Het
Dock1 A T 7: 135,138,145 E1423D possibly damaging Het
Dpf3 A T 12: 83,272,405 S44T probably damaging Het
Dyrk3 A T 1: 131,136,357 V31D possibly damaging Het
F5 T C 1: 164,194,200 S1415P probably benign Het
Fam186b A C 15: 99,271,285 I927S probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fer1l6 G A 15: 58,638,094 probably null Het
Fndc7 G T 3: 108,876,545 S249R probably benign Het
Ganab A G 19: 8,907,250 E139G possibly damaging Het
Gbp5 A G 3: 142,507,757 D478G probably damaging Het
Gm17324 T A 9: 78,448,298 M1K probably null Het
Gm996 G T 2: 25,578,346 R518S possibly damaging Het
Gtpbp6 T A 5: 110,106,742 R126S probably damaging Het
Hapln4 G A 8: 70,088,472 W385* probably null Het
Hmcn2 T A 2: 31,415,284 probably null Het
Hsp90ab1 A G 17: 45,568,988 V534A probably damaging Het
Kat6b C A 14: 21,670,530 T1650K probably damaging Het
Kpna1 T A 16: 36,002,905 D42E probably benign Het
Lrrc14b A G 13: 74,361,160 M376T probably benign Het
Lrrc40 A G 3: 158,054,564 probably null Het
Ltv1 T C 10: 13,192,143 T34A probably benign Het
Mga T A 2: 119,916,488 N373K probably damaging Het
Msh3 A T 13: 92,220,997 M101K probably damaging Het
Mthfd2l T C 5: 91,020,206 M320T possibly damaging Het
Mug1 G A 6: 121,861,555 E506K probably benign Het
Ngb T C 12: 87,100,729 D54G probably damaging Het
Ntrk1 A G 3: 87,791,707 F84L probably benign Het
Olfr347 A T 2: 36,734,533 I71F probably benign Het
Olfr667 T A 7: 104,916,973 T108S probably benign Het
Phf12 T A 11: 78,018,168 I358N possibly damaging Het
Plec A G 15: 76,177,601 F2577S probably damaging Het
Polr1c T A 17: 46,247,763 Y36F probably benign Het
Prob1 T C 18: 35,652,486 Y905C probably damaging Het
Ptpn23 T A 9: 110,386,293 H1433L possibly damaging Het
Rnf11 A T 4: 109,456,952 L80Q probably damaging Het
Sbp G A 17: 23,945,312 G183D probably benign Het
Scgb2b7 A T 7: 31,704,012 C90S possibly damaging Het
Slc4a9 T C 18: 36,535,418 L710P probably damaging Het
Spire1 T A 18: 67,552,600 I35F probably damaging Het
Sptbn2 T C 19: 4,745,938 V1715A possibly damaging Het
St7 T C 6: 17,819,282 F62L probably damaging Het
Svep1 C T 4: 58,118,136 G862D probably damaging Het
Syne1 A T 10: 5,022,041 M8789K probably damaging Het
Synpo2 A G 3: 123,112,772 L965P probably damaging Het
Trhde A T 10: 114,448,262 M772K probably benign Het
Ttn T A 2: 76,778,507 K15976* probably null Het
Unc13a A C 8: 71,658,001 probably null Het
Vcan T C 13: 89,703,199 E1214G possibly damaging Het
Vmn1r29 T C 6: 58,308,087 V264A probably benign Het
Vmn1r60 T A 7: 5,545,119 probably benign Het
Wdr90 C T 17: 25,860,485 R225H probably benign Het
Wnk1 G A 6: 119,969,332 T620I probably damaging Het
Zan C T 5: 137,407,706 probably benign Het
Zfp37 A T 4: 62,191,665 C387* probably null Het
Zfp521 T C 18: 13,844,840 T839A probably benign Het
Other mutations in Prkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Prkd1 APN 12 50383481 missense probably damaging 1.00
IGL00727:Prkd1 APN 12 50364661 missense probably damaging 1.00
IGL00772:Prkd1 APN 12 50383416 missense probably damaging 0.99
IGL01092:Prkd1 APN 12 50383515 splice site probably benign
IGL01457:Prkd1 APN 12 50392910 nonsense probably null
IGL01538:Prkd1 APN 12 50342142 missense probably benign
IGL01762:Prkd1 APN 12 50387230 missense probably benign 0.00
IGL01876:Prkd1 APN 12 50366348 missense probably damaging 1.00
IGL01973:Prkd1 APN 12 50366379 missense probably damaging 1.00
IGL02086:Prkd1 APN 12 50387263 missense probably benign
IGL02293:Prkd1 APN 12 50489978 missense probably damaging 0.97
IGL02454:Prkd1 APN 12 50364673 missense probably benign 0.09
IGL03309:Prkd1 APN 12 50388424 missense probably damaging 1.00
R0349:Prkd1 UTSW 12 50366356 missense probably damaging 1.00
R0627:Prkd1 UTSW 12 50490041 missense probably benign 0.00
R0899:Prkd1 UTSW 12 50385193 missense probably damaging 0.98
R1219:Prkd1 UTSW 12 50388342 missense probably damaging 1.00
R1495:Prkd1 UTSW 12 50366352 missense probably damaging 1.00
R1584:Prkd1 UTSW 12 50425515 missense probably damaging 1.00
R1665:Prkd1 UTSW 12 50394926 missense probably damaging 1.00
R1666:Prkd1 UTSW 12 50394926 missense probably damaging 1.00
R1668:Prkd1 UTSW 12 50394926 missense probably damaging 1.00
R1669:Prkd1 UTSW 12 50394926 missense probably damaging 1.00
R1735:Prkd1 UTSW 12 50342039 missense possibly damaging 0.79
R1939:Prkd1 UTSW 12 50394994 missense probably benign 0.00
R2143:Prkd1 UTSW 12 50489911 missense possibly damaging 0.77
R2145:Prkd1 UTSW 12 50489911 missense possibly damaging 0.77
R3404:Prkd1 UTSW 12 50648904 missense unknown
R3801:Prkd1 UTSW 12 50383422 missense possibly damaging 0.89
R3818:Prkd1 UTSW 12 50419884 splice site probably benign
R3906:Prkd1 UTSW 12 50388426 missense possibly damaging 0.91
R3966:Prkd1 UTSW 12 50392941 missense probably benign 0.44
R4179:Prkd1 UTSW 12 50366448 missense probably damaging 1.00
R4510:Prkd1 UTSW 12 50392979 missense possibly damaging 0.81
R4511:Prkd1 UTSW 12 50392979 missense possibly damaging 0.81
R4663:Prkd1 UTSW 12 50419848 splice site probably null
R4896:Prkd1 UTSW 12 50389962 missense probably damaging 1.00
R5070:Prkd1 UTSW 12 50394622 nonsense probably null
R5263:Prkd1 UTSW 12 50388306 missense probably damaging 1.00
R5389:Prkd1 UTSW 12 50343137 missense probably damaging 1.00
R5395:Prkd1 UTSW 12 50391432 missense probably damaging 1.00
R5855:Prkd1 UTSW 12 50392916 missense probably benign 0.03
R5967:Prkd1 UTSW 12 50364550 missense probably damaging 0.99
R5973:Prkd1 UTSW 12 50388255 missense probably damaging 0.99
R6052:Prkd1 UTSW 12 50366300 critical splice donor site probably null
R6063:Prkd1 UTSW 12 50342043 missense probably benign 0.02
R6309:Prkd1 UTSW 12 50394660 nonsense probably null
R6518:Prkd1 UTSW 12 50425495 missense probably benign 0.08
R6868:Prkd1 UTSW 12 50425537 missense probably damaging 1.00
R7256:Prkd1 UTSW 12 50388342 missense possibly damaging 0.88
R7346:Prkd1 UTSW 12 50648834 missense possibly damaging 0.86
R7815:Prkd1 UTSW 12 50425517 missense probably damaging 1.00
R8290:Prkd1 UTSW 12 50342016 missense probably damaging 1.00
R8397:Prkd1 UTSW 12 50392892 missense probably benign
X0024:Prkd1 UTSW 12 50489974 missense probably benign 0.31
X0062:Prkd1 UTSW 12 50394922 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTATGCTGGACTCCGCATGAC -3'
(R):5'- GCAGATCCTGCTTGAGATGTCCC -3'

Sequencing Primer
(F):5'- AGATGATATACTTCACCCTTGCAGTC -3'
(R):5'- GCAATTCACCATGCTAGAACTTAG -3'
Posted On2013-05-23