Mutagenetix > Incidental Mutation

Incidental Mutation 'R0457:Cmya5'

41246

Institutional Source

Beutler Lab

Gene Symbol

Cmya5

Ensembl Gene

ENSMUSG00000047419

Gene Name

cardiomyopathy associated 5

Synonyms

Myospryn, 2310076E21Rik, 2310076E16Rik

MMRRC Submission

038657-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.326) question?

Stock #

R0457 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

93040713-93144724 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 93095587 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 998 (W998R)

Ref Sequence

ENSEMBL: ENSMUSP00000050408 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062122]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000062122
AA Change: W998R

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419
AA Change: W998R

Domain	Start	End	E-Value	Type
low complexity region	20	46	N/A	INTRINSIC
low complexity region	129	140	N/A	INTRINSIC
internal_repeat_1	448	535	5.09e-18	PROSPERO
internal_repeat_1	543	625	5.09e-18	PROSPERO
low complexity region	626	645	N/A	INTRINSIC
low complexity region	679	691	N/A	INTRINSIC
low complexity region	734	741	N/A	INTRINSIC
low complexity region	1001	1010	N/A	INTRINSIC
low complexity region	1166	1183	N/A	INTRINSIC
low complexity region	1259	1267	N/A	INTRINSIC
low complexity region	1440	1449	N/A	INTRINSIC
low complexity region	1876	1889	N/A	INTRINSIC
low complexity region	2632	2645	N/A	INTRINSIC
low complexity region	3048	3057	N/A	INTRINSIC
FN3	3312	3399	7.29e-4	SMART
FN3	3411	3492	1.3e0	SMART
Pfam:SPRY	3551	3668	6.7e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224009

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy5	T	C	16: 35,274,545	S691P	probably benign	Het
Aspscr1	A	G	11: 120,677,618	E12G	probably benign	Het
Atp2a2	T	C	5: 122,469,714	Q244R	probably benign	Het
Birc6	A	G	17: 74,652,028	M3818V	probably benign	Het
Birc6	C	T	17: 74,662,625	A4230V	probably damaging	Het
Bub1b	T	C	2: 118,609,859	F148S	probably damaging	Het
C130079G13Rik	A	G	3: 59,936,633	I249M	possibly damaging	Het
C1ra	T	C	6: 124,522,753	S633P	probably benign	Het
Cacna2d1	A	G	5: 16,267,416	T274A	probably damaging	Het
Crbn	T	C	6: 106,781,057	K404R	probably benign	Het
Cryga	T	C	1: 65,103,045	Y63C	probably damaging	Het
Csmd1	C	A	8: 16,501,393		probably null	Het
Defa-ps1	A	T	8: 21,695,742		noncoding transcript	Het
Dnajc10	T	A	2: 80,344,946	V559D	possibly damaging	Het
Dock1	A	T	7: 135,138,145	E1423D	possibly damaging	Het
Dpf3	A	T	12: 83,272,405	S44T	probably damaging	Het
Dyrk3	A	T	1: 131,136,357	V31D	possibly damaging	Het
F5	T	C	1: 164,194,200	S1415P	probably benign	Het
Fam186b	A	C	15: 99,271,285	I927S	probably benign	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Fer1l6	G	A	15: 58,638,094		probably null	Het
Fndc7	G	T	3: 108,876,545	S249R	probably benign	Het
Ganab	A	G	19: 8,907,250	E139G	possibly damaging	Het
Gbp5	A	G	3: 142,507,757	D478G	probably damaging	Het
Gm17324	T	A	9: 78,448,298	M1K	probably null	Het
Gm996	G	T	2: 25,578,346	R518S	possibly damaging	Het
Gtpbp6	T	A	5: 110,106,742	R126S	probably damaging	Het
Hapln4	G	A	8: 70,088,472	W385*	probably null	Het
Hmcn2	T	A	2: 31,415,284		probably null	Het
Hsp90ab1	A	G	17: 45,568,988	V534A	probably damaging	Het
Kat6b	C	A	14: 21,670,530	T1650K	probably damaging	Het
Kpna1	T	A	16: 36,002,905	D42E	probably benign	Het
Lrrc14b	A	G	13: 74,361,160	M376T	probably benign	Het
Lrrc40	A	G	3: 158,054,564		probably null	Het
Ltv1	T	C	10: 13,192,143	T34A	probably benign	Het
Mga	T	A	2: 119,916,488	N373K	probably damaging	Het
Msh3	A	T	13: 92,220,997	M101K	probably damaging	Het
Mthfd2l	T	C	5: 91,020,206	M320T	possibly damaging	Het
Mug1	G	A	6: 121,861,555	E506K	probably benign	Het
Ngb	T	C	12: 87,100,729	D54G	probably damaging	Het
Ntrk1	A	G	3: 87,791,707	F84L	probably benign	Het
Olfr347	A	T	2: 36,734,533	I71F	probably benign	Het
Olfr667	T	A	7: 104,916,973	T108S	probably benign	Het
Phf12	T	A	11: 78,018,168	I358N	possibly damaging	Het
Plec	A	G	15: 76,177,601	F2577S	probably damaging	Het
Polr1c	T	A	17: 46,247,763	Y36F	probably benign	Het
Prkd1	A	T	12: 50,366,372	M672K	probably damaging	Het
Prob1	T	C	18: 35,652,486	Y905C	probably damaging	Het
Ptpn23	T	A	9: 110,386,293	H1433L	possibly damaging	Het
Rnf11	A	T	4: 109,456,952	L80Q	probably damaging	Het
Sbp	G	A	17: 23,945,312	G183D	probably benign	Het
Scgb2b7	A	T	7: 31,704,012	C90S	possibly damaging	Het
Slc4a9	T	C	18: 36,535,418	L710P	probably damaging	Het
Spire1	T	A	18: 67,552,600	I35F	probably damaging	Het
Sptbn2	T	C	19: 4,745,938	V1715A	possibly damaging	Het
St7	T	C	6: 17,819,282	F62L	probably damaging	Het
Svep1	C	T	4: 58,118,136	G862D	probably damaging	Het
Syne1	A	T	10: 5,022,041	M8789K	probably damaging	Het
Synpo2	A	G	3: 123,112,772	L965P	probably damaging	Het
Trhde	A	T	10: 114,448,262	M772K	probably benign	Het
Ttn	T	A	2: 76,778,507	K15976*	probably null	Het
Unc13a	A	C	8: 71,658,001		probably null	Het
Vcan	T	C	13: 89,703,199	E1214G	possibly damaging	Het
Vmn1r29	T	C	6: 58,308,087	V264A	probably benign	Het
Vmn1r60	T	A	7: 5,545,119		probably benign	Het
Wdr90	C	T	17: 25,860,485	R225H	probably benign	Het
Wnk1	G	A	6: 119,969,332	T620I	probably damaging	Het
Zan	C	T	5: 137,407,706		probably benign	Het
Zfp37	A	T	4: 62,191,665	C387*	probably null	Het
Zfp521	T	C	18: 13,844,840	T839A	probably benign	Het

Other mutations in Cmya5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Cmya5	APN	13	93093120	missense	probably benign	0.13
IGL00516:Cmya5	APN	13	93098167	missense	possibly damaging	0.73
IGL00654:Cmya5	APN	13	93094161	missense	probably benign	0.00
IGL00948:Cmya5	APN	13	93091036	missense	probably benign
IGL00966:Cmya5	APN	13	93097906	missense	probably benign	0.33
IGL00988:Cmya5	APN	13	93097933	missense	possibly damaging	0.96
IGL01106:Cmya5	APN	13	93084612	missense	probably damaging	1.00
IGL01331:Cmya5	APN	13	93096946	missense	possibly damaging	0.53
IGL01392:Cmya5	APN	13	93089206	missense	probably damaging	0.99
IGL01508:Cmya5	APN	13	93094027	missense	probably benign
IGL01679:Cmya5	APN	13	93065320	missense	probably damaging	1.00
IGL01749:Cmya5	APN	13	93089299	missense	probably benign	0.00
IGL01861:Cmya5	APN	13	93089748	missense	probably damaging	1.00
IGL02021:Cmya5	APN	13	93094549	missense	probably benign	0.00
IGL02034:Cmya5	APN	13	93084535	splice site	probably benign
IGL02103:Cmya5	APN	13	93092127	missense	probably benign	0.05
IGL02174:Cmya5	APN	13	93048907	missense	possibly damaging	0.76
IGL02176:Cmya5	APN	13	93090150	missense	probably damaging	1.00
IGL02210:Cmya5	APN	13	93092734	missense	probably benign	0.14
IGL02229:Cmya5	APN	13	93092686	missense	possibly damaging	0.54
IGL02306:Cmya5	APN	13	93098019	missense	probably damaging	1.00
IGL02311:Cmya5	APN	13	93090655	missense	probably benign	0.40
IGL02409:Cmya5	APN	13	93090198	missense	probably damaging	0.96
IGL02561:Cmya5	APN	13	93091858	missense	probably benign	0.00
IGL02676:Cmya5	APN	13	93092853	missense	probably damaging	1.00
IGL02683:Cmya5	APN	13	93090997	nonsense	probably null
IGL02685:Cmya5	APN	13	93090997	nonsense	probably null
IGL02686:Cmya5	APN	13	93090997	nonsense	probably null
IGL02724:Cmya5	APN	13	93096655	missense	probably benign
IGL02727:Cmya5	APN	13	93098245	missense	possibly damaging	0.73
IGL02965:Cmya5	APN	13	93092557	missense	probably benign	0.41
IGL03079:Cmya5	APN	13	93097701	missense	possibly damaging	0.85
IGL03144:Cmya5	APN	13	93090868	missense	probably damaging	1.00
IGL03253:Cmya5	APN	13	93091270	nonsense	probably null
IGL03336:Cmya5	APN	13	93093505	missense	possibly damaging	0.84
IGL03138:Cmya5	UTSW	13	93065342	missense	probably damaging	1.00
P0023:Cmya5	UTSW	13	93089346	missense	probably benign	0.22
P4748:Cmya5	UTSW	13	93074475	splice site	probably benign
R0123:Cmya5	UTSW	13	93095904	missense	possibly damaging	0.84
R0206:Cmya5	UTSW	13	93095557	missense	probably damaging	0.98
R0206:Cmya5	UTSW	13	93095557	missense	probably damaging	0.98
R0242:Cmya5	UTSW	13	93095600	missense	probably benign
R0242:Cmya5	UTSW	13	93095600	missense	probably benign
R0331:Cmya5	UTSW	13	93144403	missense	possibly damaging	0.53
R0363:Cmya5	UTSW	13	93094869	missense	possibly damaging	0.77
R0382:Cmya5	UTSW	13	93092748	missense	probably benign	0.06
R0416:Cmya5	UTSW	13	93089856	missense	probably benign	0.05
R0446:Cmya5	UTSW	13	93093656	missense	probably benign
R0673:Cmya5	UTSW	13	93089997	missense	probably damaging	1.00
R0674:Cmya5	UTSW	13	93092791	missense	probably damaging	1.00
R0692:Cmya5	UTSW	13	93093849	nonsense	probably null
R0698:Cmya5	UTSW	13	93095557	missense	probably damaging	0.98
R1227:Cmya5	UTSW	13	93094446	missense	probably damaging	0.99
R1272:Cmya5	UTSW	13	93095112	missense	possibly damaging	0.79
R1335:Cmya5	UTSW	13	93041535	missense	possibly damaging	0.65
R1353:Cmya5	UTSW	13	93041525	missense	probably damaging	1.00
R1354:Cmya5	UTSW	13	93092058	missense	possibly damaging	0.46
R1458:Cmya5	UTSW	13	93065327	missense	probably benign	0.44
R1572:Cmya5	UTSW	13	93094269	missense	possibly damaging	0.61
R1698:Cmya5	UTSW	13	93063519	missense	probably benign	0.27
R1735:Cmya5	UTSW	13	93089789	missense	probably benign	0.11
R1743:Cmya5	UTSW	13	93097317	missense	probably benign	0.33
R1750:Cmya5	UTSW	13	93095663	missense	probably benign
R1827:Cmya5	UTSW	13	93074448	missense	possibly damaging	0.80
R2068:Cmya5	UTSW	13	93090524	missense	possibly damaging	0.93
R2088:Cmya5	UTSW	13	93092812	missense	probably damaging	1.00
R2132:Cmya5	UTSW	13	93069383	missense	probably damaging	1.00
R2216:Cmya5	UTSW	13	93093495	missense	probably damaging	1.00
R2363:Cmya5	UTSW	13	93093702	missense	probably benign	0.15
R2497:Cmya5	UTSW	13	93098005	missense	possibly damaging	0.53
R2509:Cmya5	UTSW	13	93093558	missense	probably benign	0.41
R2917:Cmya5	UTSW	13	93091064	nonsense	probably null
R2944:Cmya5	UTSW	13	93092842	nonsense	probably null
R3039:Cmya5	UTSW	13	93092250	missense	probably benign	0.12
R3078:Cmya5	UTSW	13	93048927	missense	probably damaging	0.99
R3708:Cmya5	UTSW	13	93095366	nonsense	probably null
R3717:Cmya5	UTSW	13	93092487	missense	probably benign	0.12
R3768:Cmya5	UTSW	13	93096693	missense	possibly damaging	0.73
R3769:Cmya5	UTSW	13	93096693	missense	possibly damaging	0.73
R3840:Cmya5	UTSW	13	93094632	missense	probably damaging	0.96
R3841:Cmya5	UTSW	13	93094632	missense	probably damaging	0.96
R3882:Cmya5	UTSW	13	93091219	missense	probably benign	0.07
R3888:Cmya5	UTSW	13	93093656	missense	probably benign
R3897:Cmya5	UTSW	13	93096681	missense	possibly damaging	0.72
R3952:Cmya5	UTSW	13	93089199	missense	possibly damaging	0.89
R4366:Cmya5	UTSW	13	93091956	missense	probably benign	0.36
R4471:Cmya5	UTSW	13	93092325	missense	probably benign	0.01
R4493:Cmya5	UTSW	13	93094065	missense	probably benign
R4495:Cmya5	UTSW	13	93094065	missense	probably benign
R4544:Cmya5	UTSW	13	93091918	nonsense	probably null
R4545:Cmya5	UTSW	13	93091918	nonsense	probably null
R4624:Cmya5	UTSW	13	93063551	missense	probably damaging	1.00
R4648:Cmya5	UTSW	13	93093828	missense	possibly damaging	0.84
R4824:Cmya5	UTSW	13	93093574	missense	probably benign	0.04
R4965:Cmya5	UTSW	13	93095787	missense	possibly damaging	0.84
R4967:Cmya5	UTSW	13	93090585	missense	probably damaging	1.00
R5101:Cmya5	UTSW	13	93091603	missense	possibly damaging	0.61
R5133:Cmya5	UTSW	13	93093372	missense	possibly damaging	0.79
R5139:Cmya5	UTSW	13	93096061	missense	probably benign	0.00
R5220:Cmya5	UTSW	13	93092296	missense	probably damaging	0.99
R5332:Cmya5	UTSW	13	93096195	missense	probably damaging	0.96
R5337:Cmya5	UTSW	13	93083273	missense	probably benign	0.28
R5356:Cmya5	UTSW	13	93063485	missense	probably damaging	1.00
R5401:Cmya5	UTSW	13	93091968	missense	probably damaging	1.00
R5438:Cmya5	UTSW	13	93095199	missense	possibly damaging	0.89
R5604:Cmya5	UTSW	13	93092763	missense	probably benign	0.15
R5628:Cmya5	UTSW	13	93089710	missense	probably damaging	1.00
R5666:Cmya5	UTSW	13	93045949	missense	possibly damaging	0.75
R5687:Cmya5	UTSW	13	93098176	missense	possibly damaging	0.53
R5695:Cmya5	UTSW	13	93045866	critical splice donor site	probably null
R5806:Cmya5	UTSW	13	93093937	missense	possibly damaging	0.84
R5820:Cmya5	UTSW	13	93092780	missense	probably benign	0.04
R5872:Cmya5	UTSW	13	93097435	missense	probably benign	0.01
R5875:Cmya5	UTSW	13	93095184	missense	probably benign	0.13
R5896:Cmya5	UTSW	13	93045865	critical splice donor site	probably null
R5910:Cmya5	UTSW	13	93092643	missense	probably damaging	0.98
R5969:Cmya5	UTSW	13	93089544	missense	possibly damaging	0.78
R6064:Cmya5	UTSW	13	93089649	missense	probably damaging	1.00
R6081:Cmya5	UTSW	13	93144513	unclassified	probably benign
R6102:Cmya5	UTSW	13	93094231	missense	probably benign
R6117:Cmya5	UTSW	13	93095166	missense	probably damaging	0.98
R6188:Cmya5	UTSW	13	93093444	missense	possibly damaging	0.61
R6188:Cmya5	UTSW	13	93097276	missense	possibly damaging	0.73
R6219:Cmya5	UTSW	13	93094443	missense	probably damaging	1.00
R6229:Cmya5	UTSW	13	93093306	missense	probably benign	0.41
R6346:Cmya5	UTSW	13	93092190	missense	probably damaging	1.00
R6431:Cmya5	UTSW	13	93074464	missense	possibly damaging	0.60
R6436:Cmya5	UTSW	13	93089215	missense	probably damaging	0.98
R6598:Cmya5	UTSW	13	93089808	missense	probably benign	0.05
R6649:Cmya5	UTSW	13	93098025	missense	possibly damaging	0.91
R6652:Cmya5	UTSW	13	93092895	missense	probably benign	0.04
R6652:Cmya5	UTSW	13	93093039	missense	probably damaging	0.99
R6669:Cmya5	UTSW	13	93093259	missense	probably benign	0.03
R6881:Cmya5	UTSW	13	93090292	missense	probably damaging	1.00
R6909:Cmya5	UTSW	13	93091252	missense	probably benign	0.04
R6933:Cmya5	UTSW	13	93095136	missense	probably benign	0.03
R7021:Cmya5	UTSW	13	93093555	missense	possibly damaging	0.62
R7022:Cmya5	UTSW	13	93069278	critical splice donor site	probably null
R7068:Cmya5	UTSW	13	93092697	missense	possibly damaging	0.59
R7087:Cmya5	UTSW	13	93090975	missense	probably benign	0.00
R7088:Cmya5	UTSW	13	93091864	missense	possibly damaging	0.95
R7126:Cmya5	UTSW	13	93089940	missense	probably benign	0.41
R7177:Cmya5	UTSW	13	93095328	missense	probably benign	0.00
R7188:Cmya5	UTSW	13	93046038	missense	probably damaging	1.00
R7217:Cmya5	UTSW	13	93090430	missense	probably damaging	1.00
R7278:Cmya5	UTSW	13	93095700	missense	probably damaging	0.96
R7293:Cmya5	UTSW	13	93092797	missense	possibly damaging	0.90
R7332:Cmya5	UTSW	13	93092553	missense	possibly damaging	0.60
R7375:Cmya5	UTSW	13	93091661	missense	probably damaging	0.97
R7386:Cmya5	UTSW	13	93069323	missense	probably damaging	1.00
R7489:Cmya5	UTSW	13	93091838	missense	possibly damaging	0.87
R7529:Cmya5	UTSW	13	93097434	missense	probably benign	0.02
R7552:Cmya5	UTSW	13	93069312	missense	probably benign	0.41
R7624:Cmya5	UTSW	13	93090357	missense	possibly damaging	0.79
R7637:Cmya5	UTSW	13	93083212	missense	possibly damaging	0.87
R7673:Cmya5	UTSW	13	93094121	missense	probably benign	0.13
R7753:Cmya5	UTSW	13	93098172	missense	probably benign	0.18
R7757:Cmya5	UTSW	13	93098272	missense	possibly damaging	0.53
R7806:Cmya5	UTSW	13	93094262	missense	probably benign	0.00
R7825:Cmya5	UTSW	13	93097628	missense	possibly damaging	0.53
R7878:Cmya5	UTSW	13	93089757	missense	probably damaging	0.98
R7892:Cmya5	UTSW	13	93096357	missense	probably damaging	0.96
R7952:Cmya5	UTSW	13	93097004	small deletion	probably benign
R8127:Cmya5	UTSW	13	93094614	missense	probably damaging	0.99
R8256:Cmya5	UTSW	13	93093478	missense	possibly damaging	0.62
R8339:Cmya5	UTSW	13	93091634	nonsense	probably null
R8446:Cmya5	UTSW	13	93093828	missense	possibly damaging	0.84
R8553:Cmya5	UTSW	13	93093796	missense	probably benign	0.00
R8686:Cmya5	UTSW	13	93095380	missense	possibly damaging	0.91
R8748:Cmya5	UTSW	13	93089721	missense	probably damaging	1.00
R8783:Cmya5	UTSW	13	93089380	missense	possibly damaging	0.58
R8803:Cmya5	UTSW	13	93041483	missense	probably damaging	1.00
R8810:Cmya5	UTSW	13	93063540	missense	possibly damaging	0.47
R8937:Cmya5	UTSW	13	93096332	missense	probably benign	0.01
R8985:Cmya5	UTSW	13	93097156	missense	possibly damaging	0.73
R9017:Cmya5	UTSW	13	93092064	missense	probably benign	0.03
R9087:Cmya5	UTSW	13	93097203	missense	possibly damaging	0.72
R9133:Cmya5	UTSW	13	93097600	missense	possibly damaging	0.73
R9156:Cmya5	UTSW	13	93097370	missense	unknown
R9209:Cmya5	UTSW	13	93090358	missense	probably benign	0.45
R9222:Cmya5	UTSW	13	93094071	missense	probably benign	0.00
R9229:Cmya5	UTSW	13	93095668	missense	possibly damaging	0.92
R9382:Cmya5	UTSW	13	93093376	missense	probably benign
R9385:Cmya5	UTSW	13	93094372	missense	probably damaging	0.99
R9418:Cmya5	UTSW	13	93089701	missense	probably benign	0.22
R9452:Cmya5	UTSW	13	93095886	missense	probably benign
R9492:Cmya5	UTSW	13	93041314	makesense	probably null
R9600:Cmya5	UTSW	13	93090096	missense	probably damaging	1.00
R9712:Cmya5	UTSW	13	93065373	critical splice acceptor site	probably null
R9742:Cmya5	UTSW	13	93095427	missense	possibly damaging	0.89
RF020:Cmya5	UTSW	13	93069291	missense	possibly damaging	0.56
X0028:Cmya5	UTSW	13	93096687	missense	possibly damaging	0.53
Z1088:Cmya5	UTSW	13	93063579	missense	probably benign
Z1176:Cmya5	UTSW	13	93063579	missense	probably benign
Z1176:Cmya5	UTSW	13	93096790	missense	unknown
Z1177:Cmya5	UTSW	13	93063579	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCTGACGCAAATGCAGAATCAGGG -3'
(R):5'- GTTTCGCATCAGATTCAAAGCTGCC -3'

Sequencing Primer
(F):5'- CAAATGCAGAATCAGGGGAAAG -3'
(R):5'- GGTTTCACAAAATGCAACACGG -3'

Posted On

2013-05-23