Mutagenetix > Incidental Mutations

Incidental Mutation 'R0457:Spire1'

41265

Institutional Source

Beutler Lab

Gene Symbol

Spire1

Ensembl Gene

ENSMUSG00000024533

Gene Name

spire type actin nucleation factor 1

Synonyms

6030430B19Rik, Spir-1

MMRRC Submission

038657-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.278) question?

Stock #

R0457 (G1)

Quality Score

210

Status

Not validated

Chromosome

Chromosomal Location

67488209-67610790 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 67552600 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 35 (I35F)

Ref Sequence

ENSEMBL: ENSMUSP00000049336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045105] [ENSMUST00000082243] [ENSMUST00000115050] [ENSMUST00000224799]

Predicted Effect

probably damaging
Transcript: ENSMUST00000045105
AA Change: I35F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000049336
Gene: ENSMUSG00000024533
AA Change: I35F

Domain	Start	End	E-Value	Type
Pfam:KIND	1	78	3.3e-27	PFAM
PDB:4EFH\|B	176	232	9e-6	PDB
low complexity region	289	316	N/A	INTRINSIC
low complexity region	339	350	N/A	INTRINSIC
SCOP:d1zbdb_	445	518	1e-7	SMART
low complexity region	596	606	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000082243
AA Change: I35F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000080871
Gene: ENSMUSG00000024533
AA Change: I35F

Domain	Start	End	E-Value	Type
Blast:KIND	1	73	2e-26	BLAST
PDB:3RBW\|D	1	79	3e-28	PDB
PDB:4EFH\|B	176	232	9e-6	PDB
low complexity region	302	329	N/A	INTRINSIC
low complexity region	352	363	N/A	INTRINSIC
SCOP:d1zbdb_	400	473	2e-7	SMART
low complexity region	551	561	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115050
AA Change: I35F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000110702
Gene: ENSMUSG00000024533
AA Change: I35F

Domain	Start	End	E-Value	Type
PDB:4EFH\|B	106	162	9e-6	PDB
low complexity region	219	246	N/A	INTRINSIC
low complexity region	269	280	N/A	INTRINSIC
SCOP:d1zbdb_	317	390	4e-7	SMART
low complexity region	468	478	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000224799

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spire proteins, such as SPIRE1, are highly conserved between species. They belong to the family of Wiskott-Aldrich homology region-2 (WH2) proteins, which are involved in actin organization (Kerkhoff et al., 2001 [PubMed 11747823]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with normal brain anatomy and intact visual and motor functions in both sexes, but show a male-specific increase in contextual and cued fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy5	T	C	16: 35,274,545	S691P	probably benign	Het
Aspscr1	A	G	11: 120,677,618	E12G	probably benign	Het
Atp2a2	T	C	5: 122,469,714	Q244R	probably benign	Het
Birc6	A	G	17: 74,652,028	M3818V	probably benign	Het
Birc6	C	T	17: 74,662,625	A4230V	probably damaging	Het
Bub1b	T	C	2: 118,609,859	F148S	probably damaging	Het
C130079G13Rik	A	G	3: 59,936,633	I249M	possibly damaging	Het
C1ra	T	C	6: 124,522,753	S633P	probably benign	Het
Cacna2d1	A	G	5: 16,267,416	T274A	probably damaging	Het
Cmya5	A	G	13: 93,095,587	W998R	possibly damaging	Het
Crbn	T	C	6: 106,781,057	K404R	probably benign	Het
Cryga	T	C	1: 65,103,045	Y63C	probably damaging	Het
Csmd1	C	A	8: 16,501,393		probably null	Het
Defa-ps1	A	T	8: 21,695,742		noncoding transcript	Het
Dnajc10	T	A	2: 80,344,946	V559D	possibly damaging	Het
Dock1	A	T	7: 135,138,145	E1423D	possibly damaging	Het
Dpf3	A	T	12: 83,272,405	S44T	probably damaging	Het
Dyrk3	A	T	1: 131,136,357	V31D	possibly damaging	Het
F5	T	C	1: 164,194,200	S1415P	probably benign	Het
Fam186b	A	C	15: 99,271,285	I927S	probably benign	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Fer1l6	G	A	15: 58,638,094		probably null	Het
Fndc7	G	T	3: 108,876,545	S249R	probably benign	Het
Ganab	A	G	19: 8,907,250	E139G	possibly damaging	Het
Gbp5	A	G	3: 142,507,757	D478G	probably damaging	Het
Gm17324	T	A	9: 78,448,298	M1K	probably null	Het
Gm996	G	T	2: 25,578,346	R518S	possibly damaging	Het
Gtpbp6	T	A	5: 110,106,742	R126S	probably damaging	Het
Hapln4	G	A	8: 70,088,472	W385*	probably null	Het
Hmcn2	T	A	2: 31,415,284		probably null	Het
Hsp90ab1	A	G	17: 45,568,988	V534A	probably damaging	Het
Kat6b	C	A	14: 21,670,530	T1650K	probably damaging	Het
Kpna1	T	A	16: 36,002,905	D42E	probably benign	Het
Lrrc14b	A	G	13: 74,361,160	M376T	probably benign	Het
Lrrc40	A	G	3: 158,054,564		probably null	Het
Ltv1	T	C	10: 13,192,143	T34A	probably benign	Het
Mga	T	A	2: 119,916,488	N373K	probably damaging	Het
Msh3	A	T	13: 92,220,997	M101K	probably damaging	Het
Mthfd2l	T	C	5: 91,020,206	M320T	possibly damaging	Het
Mug1	G	A	6: 121,861,555	E506K	probably benign	Het
Ngb	T	C	12: 87,100,729	D54G	probably damaging	Het
Ntrk1	A	G	3: 87,791,707	F84L	probably benign	Het
Olfr347	A	T	2: 36,734,533	I71F	probably benign	Het
Olfr667	T	A	7: 104,916,973	T108S	probably benign	Het
Phf12	T	A	11: 78,018,168	I358N	possibly damaging	Het
Plec	A	G	15: 76,177,601	F2577S	probably damaging	Het
Polr1c	T	A	17: 46,247,763	Y36F	probably benign	Het
Prkd1	A	T	12: 50,366,372	M672K	probably damaging	Het
Prob1	T	C	18: 35,652,486	Y905C	probably damaging	Het
Ptpn23	T	A	9: 110,386,293	H1433L	possibly damaging	Het
Rnf11	A	T	4: 109,456,952	L80Q	probably damaging	Het
Sbp	G	A	17: 23,945,312	G183D	probably benign	Het
Scgb2b7	A	T	7: 31,704,012	C90S	possibly damaging	Het
Slc4a9	T	C	18: 36,535,418	L710P	probably damaging	Het
Sptbn2	T	C	19: 4,745,938	V1715A	possibly damaging	Het
St7	T	C	6: 17,819,282	F62L	probably damaging	Het
Svep1	C	T	4: 58,118,136	G862D	probably damaging	Het
Syne1	A	T	10: 5,022,041	M8789K	probably damaging	Het
Synpo2	A	G	3: 123,112,772	L965P	probably damaging	Het
Trhde	A	T	10: 114,448,262	M772K	probably benign	Het
Ttn	T	A	2: 76,778,507	K15976*	probably null	Het
Unc13a	A	C	8: 71,658,001		probably null	Het
Vcan	T	C	13: 89,703,199	E1214G	possibly damaging	Het
Vmn1r29	T	C	6: 58,308,087	V264A	probably benign	Het
Vmn1r60	T	A	7: 5,545,119		probably benign	Het
Wdr90	C	T	17: 25,860,485	R225H	probably benign	Het
Wnk1	G	A	6: 119,969,332	T620I	probably damaging	Het
Zan	C	T	5: 137,407,706		probably benign	Het
Zfp37	A	T	4: 62,191,665	C387*	probably null	Het
Zfp521	T	C	18: 13,844,840	T839A	probably benign	Het

Other mutations in Spire1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Spire1	APN	18	67529015	missense	probably damaging	1.00
IGL01639:Spire1	APN	18	67545668	missense	possibly damaging	0.74
IGL02334:Spire1	APN	18	67506655	missense	probably benign	0.00
PIT4677001:Spire1	UTSW	18	67491365	missense	probably damaging	1.00
R0531:Spire1	UTSW	18	67491305	missense	probably damaging	1.00
R0608:Spire1	UTSW	18	67528875	missense	probably damaging	0.99
R2098:Spire1	UTSW	18	67503466	missense	probably damaging	0.99
R2299:Spire1	UTSW	18	67530423	missense	probably damaging	1.00
R3028:Spire1	UTSW	18	67491347	missense	probably damaging	1.00
R3815:Spire1	UTSW	18	67506663	missense	probably benign	0.05
R4049:Spire1	UTSW	18	67529031	splice site	probably null
R4050:Spire1	UTSW	18	67529031	splice site	probably null
R4059:Spire1	UTSW	18	67545713	missense	probably damaging	0.98
R4109:Spire1	UTSW	18	67497217	missense	probably damaging	1.00
R4700:Spire1	UTSW	18	67512865	missense	probably benign	0.01
R4941:Spire1	UTSW	18	67519314	missense	possibly damaging	0.54
R4995:Spire1	UTSW	18	67552779	splice site	probably null
R5363:Spire1	UTSW	18	67506555	missense	probably damaging	1.00
R5561:Spire1	UTSW	18	67506646	missense	probably damaging	0.96
R5795:Spire1	UTSW	18	67495195	missense	probably benign
R5952:Spire1	UTSW	18	67506709	missense	probably benign	0.00
R5982:Spire1	UTSW	18	67497316	critical splice acceptor site	probably null
R7388:Spire1	UTSW	18	67519880	missense	probably damaging	1.00
R7559:Spire1	UTSW	18	67501117	missense	probably benign	0.04
R8006:Spire1	UTSW	18	67501181	nonsense	probably null
R8111:Spire1	UTSW	18	67519321	missense	probably damaging	0.98
R8675:Spire1	UTSW	18	67491308	missense	possibly damaging	0.48
T0970:Spire1	UTSW	18	67501063	splice site	probably null
Z1088:Spire1	UTSW	18	67495152	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GCTCAGTCTTCAGTACAGAGTCACTTG -3'
(R):5'- GCATTGGACTATGGCTTGAAGGAAAAC -3'

Sequencing Primer
(F):5'- ACAGAGTCACTTGCTGATGC -3'
(R):5'- CGAAGAAAGGGAGCTGAGCC -3'

Posted On

2013-05-23