Incidental Mutation 'R0457:Ganab'
ID41268
Institutional Source Beutler Lab
Gene Symbol Ganab
Ensembl Gene ENSMUSG00000071650
Gene Namealpha glucosidase 2 alpha neutral subunit
SynonymsG2an, GluII
MMRRC Submission 038657-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R0457 (G1)
Quality Score185
Status Not validated
Chromosome19
Chromosomal Location8898090-8916663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8907250 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 139 (E139G)
Ref Sequence ENSEMBL: ENSMUSP00000093965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096246]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096246
AA Change: E139G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093965
Gene: ENSMUSG00000071650
AA Change: E139G

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 157 169 N/A INTRINSIC
Pfam:Gal_mutarotas_2 275 346 3.9e-24 PFAM
Pfam:Glyco_hydro_31 387 832 8.7e-136 PFAM
low complexity region 888 898 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of glucosidase II and a member of the glycosyl hydrolase 31 family of proteins. The heterodimeric enzyme glucosidase II plays a role in protein folding and quality control by cleaving glucose residues from immature glycoproteins in the endoplasmic reticulum. Expression of the encoded protein is elevated in lung tumor tissue and in response to UV irradiation. Mutations in this gene cause autosomal-dominant polycystic kidney and liver disease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 T C 16: 35,274,545 S691P probably benign Het
Aspscr1 A G 11: 120,677,618 E12G probably benign Het
Atp2a2 T C 5: 122,469,714 Q244R probably benign Het
Birc6 A G 17: 74,652,028 M3818V probably benign Het
Birc6 C T 17: 74,662,625 A4230V probably damaging Het
Bub1b T C 2: 118,609,859 F148S probably damaging Het
C130079G13Rik A G 3: 59,936,633 I249M possibly damaging Het
C1ra T C 6: 124,522,753 S633P probably benign Het
Cacna2d1 A G 5: 16,267,416 T274A probably damaging Het
Cmya5 A G 13: 93,095,587 W998R possibly damaging Het
Crbn T C 6: 106,781,057 K404R probably benign Het
Cryga T C 1: 65,103,045 Y63C probably damaging Het
Csmd1 C A 8: 16,501,393 probably null Het
Defa-ps1 A T 8: 21,695,742 noncoding transcript Het
Dnajc10 T A 2: 80,344,946 V559D possibly damaging Het
Dock1 A T 7: 135,138,145 E1423D possibly damaging Het
Dpf3 A T 12: 83,272,405 S44T probably damaging Het
Dyrk3 A T 1: 131,136,357 V31D possibly damaging Het
F5 T C 1: 164,194,200 S1415P probably benign Het
Fam186b A C 15: 99,271,285 I927S probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fer1l6 G A 15: 58,638,094 probably null Het
Fndc7 G T 3: 108,876,545 S249R probably benign Het
Gbp5 A G 3: 142,507,757 D478G probably damaging Het
Gm17324 T A 9: 78,448,298 M1K probably null Het
Gm996 G T 2: 25,578,346 R518S possibly damaging Het
Gtpbp6 T A 5: 110,106,742 R126S probably damaging Het
Hapln4 G A 8: 70,088,472 W385* probably null Het
Hmcn2 T A 2: 31,415,284 probably null Het
Hsp90ab1 A G 17: 45,568,988 V534A probably damaging Het
Kat6b C A 14: 21,670,530 T1650K probably damaging Het
Kpna1 T A 16: 36,002,905 D42E probably benign Het
Lrrc14b A G 13: 74,361,160 M376T probably benign Het
Lrrc40 A G 3: 158,054,564 probably null Het
Ltv1 T C 10: 13,192,143 T34A probably benign Het
Mga T A 2: 119,916,488 N373K probably damaging Het
Msh3 A T 13: 92,220,997 M101K probably damaging Het
Mthfd2l T C 5: 91,020,206 M320T possibly damaging Het
Mug1 G A 6: 121,861,555 E506K probably benign Het
Ngb T C 12: 87,100,729 D54G probably damaging Het
Ntrk1 A G 3: 87,791,707 F84L probably benign Het
Olfr347 A T 2: 36,734,533 I71F probably benign Het
Olfr667 T A 7: 104,916,973 T108S probably benign Het
Phf12 T A 11: 78,018,168 I358N possibly damaging Het
Plec A G 15: 76,177,601 F2577S probably damaging Het
Polr1c T A 17: 46,247,763 Y36F probably benign Het
Prkd1 A T 12: 50,366,372 M672K probably damaging Het
Prob1 T C 18: 35,652,486 Y905C probably damaging Het
Ptpn23 T A 9: 110,386,293 H1433L possibly damaging Het
Rnf11 A T 4: 109,456,952 L80Q probably damaging Het
Sbp G A 17: 23,945,312 G183D probably benign Het
Scgb2b7 A T 7: 31,704,012 C90S possibly damaging Het
Slc4a9 T C 18: 36,535,418 L710P probably damaging Het
Spire1 T A 18: 67,552,600 I35F probably damaging Het
Sptbn2 T C 19: 4,745,938 V1715A possibly damaging Het
St7 T C 6: 17,819,282 F62L probably damaging Het
Svep1 C T 4: 58,118,136 G862D probably damaging Het
Syne1 A T 10: 5,022,041 M8789K probably damaging Het
Synpo2 A G 3: 123,112,772 L965P probably damaging Het
Trhde A T 10: 114,448,262 M772K probably benign Het
Ttn T A 2: 76,778,507 K15976* probably null Het
Unc13a A C 8: 71,658,001 probably null Het
Vcan T C 13: 89,703,199 E1214G possibly damaging Het
Vmn1r29 T C 6: 58,308,087 V264A probably benign Het
Vmn1r60 T A 7: 5,545,119 probably benign Het
Wdr90 C T 17: 25,860,485 R225H probably benign Het
Wnk1 G A 6: 119,969,332 T620I probably damaging Het
Zan C T 5: 137,407,706 probably benign Het
Zfp37 A T 4: 62,191,665 C387* probably null Het
Zfp521 T C 18: 13,844,840 T839A probably benign Het
Other mutations in Ganab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Ganab APN 19 8902595 missense probably benign
IGL00434:Ganab APN 19 8907343 missense probably damaging 1.00
IGL01415:Ganab APN 19 8914694 splice site probably benign
IGL02418:Ganab APN 19 8911069 missense probably null 0.97
IGL02886:Ganab APN 19 8911027 splice site probably benign
IGL02997:Ganab APN 19 8915412 missense probably benign 0.00
IGL03108:Ganab APN 19 8912476 missense probably damaging 1.00
R0240:Ganab UTSW 19 8912813 missense possibly damaging 0.58
R0240:Ganab UTSW 19 8912813 missense possibly damaging 0.58
R0349:Ganab UTSW 19 8911652 missense probably null 0.11
R0551:Ganab UTSW 19 8907280 missense probably benign 0.35
R0645:Ganab UTSW 19 8911113 missense probably damaging 1.00
R0652:Ganab UTSW 19 8915402 critical splice acceptor site probably null
R0688:Ganab UTSW 19 8911113 missense probably damaging 1.00
R0726:Ganab UTSW 19 8911113 missense probably damaging 1.00
R1427:Ganab UTSW 19 8915666 missense probably benign 0.00
R1946:Ganab UTSW 19 8910808 missense probably damaging 1.00
R1955:Ganab UTSW 19 8911616 nonsense probably null
R2173:Ganab UTSW 19 8902260 unclassified probably benign
R2280:Ganab UTSW 19 8909468 missense probably damaging 1.00
R2281:Ganab UTSW 19 8909468 missense probably damaging 1.00
R4897:Ganab UTSW 19 8914991 missense probably benign 0.07
R5224:Ganab UTSW 19 8910591 missense probably benign 0.35
R5269:Ganab UTSW 19 8911937 missense probably damaging 1.00
R5323:Ganab UTSW 19 8908685 missense probably benign 0.00
R5850:Ganab UTSW 19 8911707 missense probably damaging 1.00
R6469:Ganab UTSW 19 8902632 critical splice donor site probably null
R6911:Ganab UTSW 19 8907788 splice site probably null
R7284:Ganab UTSW 19 8912540 missense probably damaging 1.00
R7412:Ganab UTSW 19 8912528 missense probably benign 0.01
R7413:Ganab UTSW 19 8904975 missense probably benign 0.01
R7466:Ganab UTSW 19 8914569 nonsense probably null
R7586:Ganab UTSW 19 8911352 missense possibly damaging 0.76
R7657:Ganab UTSW 19 8907357 missense probably damaging 0.99
R7671:Ganab UTSW 19 8912852 missense possibly damaging 0.94
R7729:Ganab UTSW 19 8914712 missense probably benign 0.24
R8223:Ganab UTSW 19 8910828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCTGCTGAACCCAAGGACCTAAG -3'
(R):5'- AGTAAGTTCCCTGAAGTCCCCACC -3'

Sequencing Primer
(F):5'- agaggttagaggataatttgggg -3'
(R):5'- ACCCTGTACTCACGGGAC -3'
Posted On2013-05-23