Incidental Mutation 'R0458:Stat1'
ID41269
Institutional Source Beutler Lab
Gene Symbol Stat1
Ensembl Gene ENSMUSG00000026104
Gene Namesignal transducer and activator of transcription 1
Synonyms2010005J02Rik
MMRRC Submission 038658-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0458 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location52119440-52161865 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 52149052 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070968] [ENSMUST00000186057] [ENSMUST00000186574] [ENSMUST00000186857] [ENSMUST00000189244] [ENSMUST00000189347] [ENSMUST00000191435]
Predicted Effect probably benign
Transcript: ENSMUST00000070968
SMART Domains Protein: ENSMUSP00000066743
Gene: ENSMUSG00000026104

DomainStartEndE-ValueType
STAT_int 2 122 2.5e-61 SMART
Pfam:STAT_alpha 139 315 1.4e-56 PFAM
Pfam:STAT_bind 317 566 4.2e-82 PFAM
SH2 571 687 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 715 739 2.4e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185516
Predicted Effect probably benign
Transcript: ENSMUST00000186057
SMART Domains Protein: ENSMUSP00000141132
Gene: ENSMUSG00000026104

DomainStartEndE-ValueType
STAT_int 2 122 2.5e-61 SMART
Pfam:STAT_alpha 136 315 3.4e-65 PFAM
Pfam:STAT_bind 317 573 3.9e-118 PFAM
SH2 577 693 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 721 745 2.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186574
SMART Domains Protein: ENSMUSP00000140518
Gene: ENSMUSG00000026104

DomainStartEndE-ValueType
STAT_int 2 122 1.9e-65 SMART
Pfam:STAT_alpha 136 315 3.3e-62 PFAM
Pfam:STAT_bind 317 567 1.1e-118 PFAM
SH2 571 687 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186857
SMART Domains Protein: ENSMUSP00000140875
Gene: ENSMUSG00000026104

DomainStartEndE-ValueType
STAT_int 2 122 2.5e-61 SMART
Pfam:STAT_alpha 136 315 1.2e-64 PFAM
Pfam:STAT_bind 317 567 4.4e-121 PFAM
SH2 571 687 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 715 739 3.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189075
Predicted Effect probably benign
Transcript: ENSMUST00000189244
SMART Domains Protein: ENSMUSP00000140482
Gene: ENSMUSG00000026104

DomainStartEndE-ValueType
Pfam:STAT_bind 13 61 2.6e-14 PFAM
SH2 65 181 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 209 233 7.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189336
Predicted Effect probably benign
Transcript: ENSMUST00000189347
SMART Domains Protein: ENSMUSP00000141125
Gene: ENSMUSG00000026104

DomainStartEndE-ValueType
STAT_int 2 122 1.9e-65 SMART
Pfam:STAT_alpha 136 315 3.3e-62 PFAM
Pfam:STAT_bind 317 567 1.1e-118 PFAM
SH2 571 687 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191435
SMART Domains Protein: ENSMUSP00000139746
Gene: ENSMUSG00000026104

DomainStartEndE-ValueType
STAT_int 2 122 1.9e-65 SMART
Pfam:STAT_alpha 136 315 3.3e-62 PFAM
Pfam:STAT_bind 317 567 1.1e-118 PFAM
SH2 571 687 1e-3 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein can be activated by various ligands including interferon-alpha, interferon-gamma, EGF, PDGF and IL6. This protein mediates the expression of a variety of genes, which is thought to be important for cell viability in response to different cell stimuli and pathogens. Two alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are largely unresponsive to interferon, fail to thrive, are susceptible to viral diseases and cutaneous leishmaniasis, and show excess osteoclastogenesis leading to increased bone mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik T C 16: 92,321,107 I98V probably benign Het
4933407L21Rik A G 1: 85,929,026 E8G unknown Het
9130008F23Rik T C 17: 40,880,236 T101A probably benign Het
Abcb8 C T 5: 24,406,233 T455I probably benign Het
Abcb9 C A 5: 124,082,146 probably null Het
Akp3 T G 1: 87,126,537 Y265* probably null Het
Atp6v1b1 A T 6: 83,752,408 D109V probably damaging Het
Aurka C A 2: 172,370,446 E4* probably null Het
Cacna1g T A 11: 94,409,440 Q2168L probably damaging Het
Cdc45 T A 16: 18,781,972 probably benign Het
Cfap61 T C 2: 146,008,917 V325A probably benign Het
Clasp2 T A 9: 113,906,224 probably null Het
Crim1 T A 17: 78,313,226 I365N probably damaging Het
Dcaf8 A G 1: 172,174,043 N269S probably benign Het
Dnaaf5 T C 5: 139,161,878 V399A possibly damaging Het
Ear2 A G 14: 44,103,248 Y121C probably damaging Het
Eef2k T C 7: 120,903,290 Y692H probably damaging Het
Elavl2 A T 4: 91,308,867 probably benign Het
Epn2 C A 11: 61,546,455 R97L possibly damaging Het
Fzd6 G A 15: 39,031,281 A281T probably damaging Het
Garem2 T A 5: 30,114,182 I214N probably damaging Het
Glg1 A G 8: 111,160,606 probably benign Het
Golm1 T C 13: 59,664,364 E48G probably damaging Het
Gpaa1 G T 15: 76,332,033 R12L probably benign Het
Gstm1 T A 3: 108,017,363 T34S probably benign Het
Gtf3c1 G A 7: 125,644,134 P1766L possibly damaging Het
Herc1 A T 9: 66,476,381 Q3709L probably benign Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Icam1 A G 9: 21,027,861 probably null Het
Itga9 T C 9: 118,681,028 probably null Het
Kif15 T C 9: 123,009,359 F1121L probably benign Het
Klhl30 T A 1: 91,360,996 probably benign Het
Ldlrad1 T C 4: 107,216,190 C141R probably damaging Het
Lemd2 T C 17: 27,190,653 D508G probably damaging Het
Lilra5 A C 7: 4,238,219 T52P probably benign Het
Lrtm2 G A 6: 119,317,268 P301S probably damaging Het
Mcoln2 A G 3: 146,150,013 probably benign Het
Mkrn2os A G 6: 115,586,670 S135P probably damaging Het
Mlxipl T C 5: 135,133,370 V607A probably benign Het
Mmadhc T C 2: 50,281,161 Y213C probably benign Het
Mpo C A 11: 87,796,297 A223E probably benign Het
Mthfd2l C G 5: 91,020,177 I310M probably damaging Het
Muc5b C A 7: 141,864,972 A3885D probably benign Het
Mvp A G 7: 126,998,491 W152R probably damaging Het
Nmur2 A T 11: 56,040,568 F106I possibly damaging Het
Nr3c2 T A 8: 76,909,538 F423I probably damaging Het
Olfr1030 A G 2: 85,984,256 S139G probably benign Het
Olfr1500 G T 19: 13,828,229 H56N probably benign Het
Olfr355 A G 2: 36,927,337 V259A probably damaging Het
Olfr894 G A 9: 38,219,048 C75Y probably damaging Het
Pappa A G 4: 65,155,882 I224M probably damaging Het
Prex1 A C 2: 166,585,823 S800A probably damaging Het
Prkaca T C 8: 83,995,282 probably benign Het
Ptpru A T 4: 131,799,675 V662E possibly damaging Het
Rabep1 T A 11: 70,886,998 probably null Het
Rbms2 C T 10: 128,151,189 C50Y probably damaging Het
Rd3 C T 1: 191,977,453 P25S probably damaging Het
Rnf148 T G 6: 23,654,257 I247L probably benign Het
Sf3b3 A G 8: 110,812,136 probably benign Het
Slc35c1 A T 2: 92,454,513 F252Y probably damaging Het
Slc38a11 T C 2: 65,363,469 probably null Het
Snx6 G T 12: 54,768,136 Y17* probably null Het
Sox6 C A 7: 115,489,794 R611L probably damaging Het
Spata13 G A 14: 60,692,043 R350H probably damaging Het
Sppl2a G T 2: 126,904,959 A483D probably damaging Het
Tab2 A T 10: 7,919,555 Y314N probably damaging Het
Tor1aip1 T C 1: 156,030,407 N213S probably damaging Het
Trim39 T C 17: 36,261,512 K300E probably damaging Het
Tubal3 T C 13: 3,933,137 S306P probably damaging Het
Ufm1 A G 3: 53,861,234 L33P probably damaging Het
Washc4 G A 10: 83,546,799 V26I possibly damaging Het
Wfs1 A G 5: 36,968,669 Y293H probably damaging Het
Zbtb41 T C 1: 139,423,476 V109A probably damaging Het
Zfp667 T C 7: 6,304,845 S171P probably benign Het
Zkscan5 T A 5: 145,205,471 H59Q probably damaging Het
Zswim8 C T 14: 20,718,897 R1128W probably damaging Het
Other mutations in Stat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Stat1 APN 1 52122595 start codon destroyed probably null 0.50
IGL01111:Stat1 APN 1 52142961 critical splice donor site probably null
IGL01451:Stat1 APN 1 52139343 missense probably damaging 1.00
IGL01469:Stat1 APN 1 52147370 missense possibly damaging 0.87
IGL01758:Stat1 APN 1 52136921 missense probably damaging 1.00
IGL01818:Stat1 APN 1 52151278 missense probably damaging 1.00
IGL01913:Stat1 APN 1 52126557 missense probably benign 0.08
IGL01914:Stat1 APN 1 52126557 missense probably benign 0.08
IGL02304:Stat1 APN 1 52132544 missense probably benign
IGL02428:Stat1 APN 1 52142966 splice site probably benign
Accretion UTSW 1 52135621 missense possibly damaging 0.65
baroque UTSW 1 52144209 missense probably damaging 1.00
Compounding UTSW 1 52151281 missense probably benign 0.17
domino UTSW 1 52140588 missense probably damaging 1.00
kun_ming UTSW 1 52137416 missense possibly damaging 0.52
kuomintang UTSW 1 52151245 missense possibly damaging 0.51
poison UTSW 1 52151225 splice site probably benign
roccoco UTSW 1 52123209 missense probably damaging 1.00
rollo UTSW 1 52153923 nonsense probably null
special UTSW 1 52139264 missense probably damaging 1.00
vandegraff UTSW 1 52155019 missense probably benign 0.01
R0022:Stat1 UTSW 1 52140630 missense probably damaging 1.00
R0022:Stat1 UTSW 1 52140630 missense probably damaging 1.00
R0039:Stat1 UTSW 1 52140660 missense probably damaging 0.99
R1313:Stat1 UTSW 1 52156006 missense probably damaging 0.98
R1313:Stat1 UTSW 1 52156006 missense probably damaging 0.98
R2998:Stat1 UTSW 1 52151249 missense probably benign 0.01
R4464:Stat1 UTSW 1 52137416 missense possibly damaging 0.52
R4709:Stat1 UTSW 1 52126521 missense probably damaging 0.97
R4934:Stat1 UTSW 1 52153923 nonsense probably null
R5038:Stat1 UTSW 1 52123209 missense probably damaging 1.00
R5075:Stat1 UTSW 1 52122712 missense possibly damaging 0.73
R5223:Stat1 UTSW 1 52144242 missense probably damaging 1.00
R5600:Stat1 UTSW 1 52148942 missense probably benign 0.06
R5866:Stat1 UTSW 1 52139264 missense probably damaging 1.00
R7105:Stat1 UTSW 1 52151249 missense probably benign 0.01
R7192:Stat1 UTSW 1 52135621 missense possibly damaging 0.65
R7284:Stat1 UTSW 1 52148922 missense probably benign 0.01
R7309:Stat1 UTSW 1 52126621 splice site probably null
R7491:Stat1 UTSW 1 52152371 missense probably benign 0.31
R7680:Stat1 UTSW 1 52144209 missense probably damaging 1.00
R7825:Stat1 UTSW 1 52151308 missense probably damaging 0.98
R7915:Stat1 UTSW 1 52151281 missense probably benign 0.17
R8245:Stat1 UTSW 1 52155019 missense probably benign 0.01
R8309:Stat1 UTSW 1 52151245 missense possibly damaging 0.51
R8728:Stat1 UTSW 1 52139194 nonsense probably null
R8952:Stat1 UTSW 1 52147883 missense probably benign 0.01
RF036:Stat1 UTSW 1 52152260 missense probably benign
RF060:Stat1 UTSW 1 52152260 missense probably benign
X0027:Stat1 UTSW 1 52139271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAACTCCAGCCTCTGGGTGTTTTC -3'
(R):5'- AGACAAAACTGTGGCTCTGCCTC -3'

Sequencing Primer
(F):5'- CCTCTGGGTGTTTTCTCTGC -3'
(R):5'- TAAGATCCTGGCTCAGACATAAG -3'
Posted On2013-05-23