Mutagenetix > Incidental Mutation

Incidental Mutation 'R0458:Zbtb41'

41273

Institutional Source

Beutler Lab

Gene Symbol

Zbtb41

Ensembl Gene

ENSMUSG00000033964

Gene Name

zinc finger and BTB domain containing 41

Synonyms

9830132G07Rik, 8430415N23Rik

MMRRC Submission

038658-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.221) question?

Stock #

R0458 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

139422288-139453005 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 139423476 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 109 (V109A)

Ref Sequence

ENSEMBL: ENSMUSP00000142797 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039867] [ENSMUST00000200243]

AlphaFold

Q811F1

Predicted Effect

probably damaging
Transcript: ENSMUST00000039867
AA Change: V109A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000045570
Gene: ENSMUSG00000033964
AA Change: V109A

Domain	Start	End	E-Value	Type
low complexity region	70	81	N/A	INTRINSIC
BTB	89	183	7.06e-16	SMART
ZnF_C2H2	208	231	3.78e-1	SMART
low complexity region	234	245	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	301	327	N/A	INTRINSIC
ZnF_C2H2	360	382	4.17e-3	SMART
ZnF_C2H2	388	410	8.34e-3	SMART
ZnF_C2H2	421	444	2.67e-1	SMART
ZnF_C2H2	462	484	1.72e-4	SMART
ZnF_C2H2	490	513	1.41e0	SMART
ZnF_C2H2	517	540	1.12e-3	SMART
ZnF_C2H2	546	568	1.36e-2	SMART
ZnF_C2H2	574	596	2.91e-2	SMART
ZnF_C2H2	602	624	7.37e-4	SMART
ZnF_C2H2	630	653	3.39e-3	SMART
ZnF_C2H2	667	689	2.75e-3	SMART
ZnF_C2H2	695	717	3.16e-3	SMART
ZnF_C2H2	723	746	3.34e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000199011

Predicted Effect

probably damaging
Transcript: ENSMUST00000200243
AA Change: V109A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000142797
Gene: ENSMUSG00000033964
AA Change: V109A

Domain	Start	End	E-Value	Type
low complexity region	70	81	N/A	INTRINSIC
BTB	89	183	4.7e-18	SMART
ZnF_C2H2	208	231	1.6e-3	SMART
low complexity region	234	245	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	301	327	N/A	INTRINSIC
ZnF_C2H2	360	382	1.7e-5	SMART
ZnF_C2H2	388	410	3.5e-5	SMART
ZnF_C2H2	421	444	1.1e-3	SMART
ZnF_C2H2	462	484	7.2e-7	SMART
ZnF_C2H2	490	513	5.9e-3	SMART
ZnF_C2H2	517	540	4.7e-6	SMART
ZnF_C2H2	546	568	5.7e-5	SMART
ZnF_C2H2	574	596	1.3e-4	SMART
ZnF_C2H2	602	624	3e-6	SMART
ZnF_C2H2	630	653	1.5e-5	SMART

Meta Mutation Damage Score

0.1159

Coding Region Coverage

1x: 99.7%
3x: 98.9%
10x: 97.0%
20x: 94.3%

Validation Efficiency

100% (79/79)

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563D23Rik	T	C	16: 92,321,107	I98V	probably benign	Het
4933407L21Rik	A	G	1: 85,929,026	E8G	unknown	Het
9130008F23Rik	T	C	17: 40,880,236	T101A	probably benign	Het
Abcb8	C	T	5: 24,406,233	T455I	probably benign	Het
Abcb9	C	A	5: 124,082,146		probably null	Het
Akp3	T	G	1: 87,126,537	Y265*	probably null	Het
Atp6v1b1	A	T	6: 83,752,408	D109V	probably damaging	Het
Aurka	C	A	2: 172,370,446	E4*	probably null	Het
Cacna1g	T	A	11: 94,409,440	Q2168L	probably damaging	Het
Cdc45	T	A	16: 18,781,972		probably benign	Het
Cfap61	T	C	2: 146,008,917	V325A	probably benign	Het
Clasp2	T	A	9: 113,906,224		probably null	Het
Crim1	T	A	17: 78,313,226	I365N	probably damaging	Het
Dcaf8	A	G	1: 172,174,043	N269S	probably benign	Het
Dnaaf5	T	C	5: 139,161,878	V399A	possibly damaging	Het
Ear2	A	G	14: 44,103,248	Y121C	probably damaging	Het
Eef2k	T	C	7: 120,903,290	Y692H	probably damaging	Het
Elavl2	A	T	4: 91,308,867		probably benign	Het
Epn2	C	A	11: 61,546,455	R97L	possibly damaging	Het
Fzd6	G	A	15: 39,031,281	A281T	probably damaging	Het
Garem2	T	A	5: 30,114,182	I214N	probably damaging	Het
Glg1	A	G	8: 111,160,606		probably benign	Het
Golm1	T	C	13: 59,664,364	E48G	probably damaging	Het
Gpaa1	G	T	15: 76,332,033	R12L	probably benign	Het
Gstm1	T	A	3: 108,017,363	T34S	probably benign	Het
Gtf3c1	G	A	7: 125,644,134	P1766L	possibly damaging	Het
Herc1	A	T	9: 66,476,381	Q3709L	probably benign	Het
Hoxa13	CCG	CCGCG	6: 52,260,635		probably null	Het
Icam1	A	G	9: 21,027,861		probably null	Het
Itga9	T	C	9: 118,681,028		probably null	Het
Kif15	T	C	9: 123,009,359	F1121L	probably benign	Het
Klhl30	T	A	1: 91,360,996		probably benign	Het
Ldlrad1	T	C	4: 107,216,190	C141R	probably damaging	Het
Lemd2	T	C	17: 27,190,653	D508G	probably damaging	Het
Lilra5	A	C	7: 4,238,219	T52P	probably benign	Het
Lrtm2	G	A	6: 119,317,268	P301S	probably damaging	Het
Mcoln2	A	G	3: 146,150,013		probably benign	Het
Mkrn2os	A	G	6: 115,586,670	S135P	probably damaging	Het
Mlxipl	T	C	5: 135,133,370	V607A	probably benign	Het
Mmadhc	T	C	2: 50,281,161	Y213C	probably benign	Het
Mpo	C	A	11: 87,796,297	A223E	probably benign	Het
Mthfd2l	C	G	5: 91,020,177	I310M	probably damaging	Het
Muc5b	C	A	7: 141,864,972	A3885D	probably benign	Het
Mvp	A	G	7: 126,998,491	W152R	probably damaging	Het
Nmur2	A	T	11: 56,040,568	F106I	possibly damaging	Het
Nr3c2	T	A	8: 76,909,538	F423I	probably damaging	Het
Olfr1030	A	G	2: 85,984,256	S139G	probably benign	Het
Olfr1500	G	T	19: 13,828,229	H56N	probably benign	Het
Olfr355	A	G	2: 36,927,337	V259A	probably damaging	Het
Olfr894	G	A	9: 38,219,048	C75Y	probably damaging	Het
Pappa	A	G	4: 65,155,882	I224M	probably damaging	Het
Prex1	A	C	2: 166,585,823	S800A	probably damaging	Het
Prkaca	T	C	8: 83,995,282		probably benign	Het
Ptpru	A	T	4: 131,799,675	V662E	possibly damaging	Het
Rabep1	T	A	11: 70,886,998		probably null	Het
Rbms2	C	T	10: 128,151,189	C50Y	probably damaging	Het
Rd3	C	T	1: 191,977,453	P25S	probably damaging	Het
Rnf148	T	G	6: 23,654,257	I247L	probably benign	Het
Sf3b3	A	G	8: 110,812,136		probably benign	Het
Slc35c1	A	T	2: 92,454,513	F252Y	probably damaging	Het
Slc38a11	T	C	2: 65,363,469		probably null	Het
Snx6	G	T	12: 54,768,136	Y17*	probably null	Het
Sox6	C	A	7: 115,489,794	R611L	probably damaging	Het
Spata13	G	A	14: 60,692,043	R350H	probably damaging	Het
Sppl2a	G	T	2: 126,904,959	A483D	probably damaging	Het
Stat1	C	T	1: 52,149,052		probably benign	Het
Tab2	A	T	10: 7,919,555	Y314N	probably damaging	Het
Tor1aip1	T	C	1: 156,030,407	N213S	probably damaging	Het
Trim39	T	C	17: 36,261,512	K300E	probably damaging	Het
Tubal3	T	C	13: 3,933,137	S306P	probably damaging	Het
Ufm1	A	G	3: 53,861,234	L33P	probably damaging	Het
Washc4	G	A	10: 83,546,799	V26I	possibly damaging	Het
Wfs1	A	G	5: 36,968,669	Y293H	probably damaging	Het
Zfp667	T	C	7: 6,304,845	S171P	probably benign	Het
Zkscan5	T	A	5: 145,205,471	H59Q	probably damaging	Het
Zswim8	C	T	14: 20,718,897	R1128W	probably damaging	Het

Other mutations in Zbtb41

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00885:Zbtb41	APN	1	139430324	missense	probably benign	0.01
IGL01796:Zbtb41	APN	1	139442883	missense	probably damaging	0.99
IGL01844:Zbtb41	APN	1	139447327	missense	probably benign	0.01
IGL02150:Zbtb41	APN	1	139440448	missense	possibly damaging	0.73
IGL02346:Zbtb41	APN	1	139447100	missense	probably damaging	1.00
IGL03139:Zbtb41	APN	1	139423838	missense	probably benign	0.00
IGL03215:Zbtb41	APN	1	139446950	missense	probably damaging	1.00
IGL03309:Zbtb41	APN	1	139432078	critical splice donor site	probably null
memorialized	UTSW	1	139440394	missense	probably benign	0.00
Noted	UTSW	1	139439031	missense	probably damaging	0.99
R7584_zbtb41_939	UTSW	1	139424057	missense	probably benign	0.14
unforgotten	UTSW	1	139432078	critical splice donor site	probably null
R0004:Zbtb41	UTSW	1	139442888	missense	possibly damaging	0.90
R0010:Zbtb41	UTSW	1	139423530	missense	probably damaging	1.00
R0010:Zbtb41	UTSW	1	139423530	missense	probably damaging	1.00
R0048:Zbtb41	UTSW	1	139441834	missense	probably damaging	1.00
R0230:Zbtb41	UTSW	1	139446935	missense	probably damaging	1.00
R0309:Zbtb41	UTSW	1	139438984	missense	probably damaging	0.99
R0606:Zbtb41	UTSW	1	139423610	missense	probably benign	0.28
R0964:Zbtb41	UTSW	1	139439031	missense	probably damaging	0.99
R1531:Zbtb41	UTSW	1	139423193	missense	probably benign	0.00
R1723:Zbtb41	UTSW	1	139423563	missense	probably benign	0.39
R1765:Zbtb41	UTSW	1	139440394	missense	probably benign	0.00
R1829:Zbtb41	UTSW	1	139446922	nonsense	probably null
R2077:Zbtb41	UTSW	1	139424093	missense	probably damaging	1.00
R2292:Zbtb41	UTSW	1	139440359	missense	probably damaging	0.99
R2380:Zbtb41	UTSW	1	139423814	missense	probably damaging	0.99
R2402:Zbtb41	UTSW	1	139423185	missense	probably benign	0.10
R2402:Zbtb41	UTSW	1	139423187	nonsense	probably null
R3847:Zbtb41	UTSW	1	139423996	missense	probably benign
R3848:Zbtb41	UTSW	1	139423996	missense	probably benign
R3849:Zbtb41	UTSW	1	139423996	missense	probably benign
R4077:Zbtb41	UTSW	1	139429326	missense	probably benign	0.11
R4641:Zbtb41	UTSW	1	139442819	missense	probably damaging	0.98
R4772:Zbtb41	UTSW	1	139447414	missense	probably damaging	1.00
R5646:Zbtb41	UTSW	1	139423763	missense	probably benign	0.05
R5754:Zbtb41	UTSW	1	139432078	critical splice donor site	probably null
R6002:Zbtb41	UTSW	1	139423659	missense	probably damaging	1.00
R6045:Zbtb41	UTSW	1	139424032	missense	probably benign	0.34
R6302:Zbtb41	UTSW	1	139429289	missense	possibly damaging	0.67
R6318:Zbtb41	UTSW	1	139430306	missense	possibly damaging	0.91
R6430:Zbtb41	UTSW	1	139447207	missense	probably benign	0.02
R6906:Zbtb41	UTSW	1	139423390	missense	possibly damaging	0.59
R7584:Zbtb41	UTSW	1	139424057	missense	probably benign	0.14
R7753:Zbtb41	UTSW	1	139447157	missense	probably benign
R8132:Zbtb41	UTSW	1	139423217	missense	probably benign	0.00
R8138:Zbtb41	UTSW	1	139441807	missense	probably damaging	1.00
R8205:Zbtb41	UTSW	1	139429181	missense	possibly damaging	0.96
R8823:Zbtb41	UTSW	1	139423154	missense	probably damaging	1.00
R8967:Zbtb41	UTSW	1	139442849	missense	probably benign
R9431:Zbtb41	UTSW	1	139423043	start gained	probably benign
R9500:Zbtb41	UTSW	1	139432068	missense	probably damaging	1.00
R9559:Zbtb41	UTSW	1	139430315	missense	probably benign	0.14
R9603:Zbtb41	UTSW	1	139447517	missense	probably damaging	1.00
R9789:Zbtb41	UTSW	1	139440346	missense	probably damaging	1.00
Z1177:Zbtb41	UTSW	1	139423416	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGCAGACCATGAAACGGTGGG -3'
(R):5'- GGCCTGAAAGGCAGCAACATTCTC -3'

Sequencing Primer
(F):5'- CTCTTCGGAAGAAAATGCTGCTG -3'
(R):5'- AGCAGCTTTACCGCATCG -3'

Posted On

2013-05-23