Incidental Mutation 'R0458:Mthfd2l'
ID41296
Institutional Source Beutler Lab
Gene Symbol Mthfd2l
Ensembl Gene ENSMUSG00000029376
Gene Namemethylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
SynonymsC630010D07Rik, 1110019K23Rik
MMRRC Submission 038658-MU
Accession Numbers

Genbank: NM_026788; MGI: 1915871

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0458 (G1)
Quality Score196
Status Validated
Chromosome5
Chromosomal Location90931117-91021368 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 91020177 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 310 (I310M)
Ref Sequence ENSEMBL: ENSMUSP00000071578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071652]
Predicted Effect probably damaging
Transcript: ENSMUST00000071652
AA Change: I310M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071578
Gene: ENSMUSG00000029376
AA Change: I310M

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:THF_DHG_CYH 44 160 1.4e-40 PFAM
Pfam:THF_DHG_CYH_C 163 337 4.5e-65 PFAM
Meta Mutation Damage Score 0.2583 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (79/79)
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik T C 16: 92,321,107 I98V probably benign Het
4933407L21Rik A G 1: 85,929,026 E8G unknown Het
9130008F23Rik T C 17: 40,880,236 T101A probably benign Het
Abcb8 C T 5: 24,406,233 T455I probably benign Het
Abcb9 C A 5: 124,082,146 probably null Het
Akp3 T G 1: 87,126,537 Y265* probably null Het
Atp6v1b1 A T 6: 83,752,408 D109V probably damaging Het
Aurka C A 2: 172,370,446 E4* probably null Het
Cacna1g T A 11: 94,409,440 Q2168L probably damaging Het
Cdc45 T A 16: 18,781,972 probably benign Het
Cfap61 T C 2: 146,008,917 V325A probably benign Het
Clasp2 T A 9: 113,906,224 probably null Het
Crim1 T A 17: 78,313,226 I365N probably damaging Het
Dcaf8 A G 1: 172,174,043 N269S probably benign Het
Dnaaf5 T C 5: 139,161,878 V399A possibly damaging Het
Ear2 A G 14: 44,103,248 Y121C probably damaging Het
Eef2k T C 7: 120,903,290 Y692H probably damaging Het
Elavl2 A T 4: 91,308,867 probably benign Het
Epn2 C A 11: 61,546,455 R97L possibly damaging Het
Fzd6 G A 15: 39,031,281 A281T probably damaging Het
Garem2 T A 5: 30,114,182 I214N probably damaging Het
Glg1 A G 8: 111,160,606 probably benign Het
Golm1 T C 13: 59,664,364 E48G probably damaging Het
Gpaa1 G T 15: 76,332,033 R12L probably benign Het
Gstm1 T A 3: 108,017,363 T34S probably benign Het
Gtf3c1 G A 7: 125,644,134 P1766L possibly damaging Het
Herc1 A T 9: 66,476,381 Q3709L probably benign Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Icam1 A G 9: 21,027,861 probably null Het
Itga9 T C 9: 118,681,028 probably null Het
Kif15 T C 9: 123,009,359 F1121L probably benign Het
Klhl30 T A 1: 91,360,996 probably benign Het
Ldlrad1 T C 4: 107,216,190 C141R probably damaging Het
Lemd2 T C 17: 27,190,653 D508G probably damaging Het
Lilra5 A C 7: 4,238,219 T52P probably benign Het
Lrtm2 G A 6: 119,317,268 P301S probably damaging Het
Mcoln2 A G 3: 146,150,013 probably benign Het
Mkrn2os A G 6: 115,586,670 S135P probably damaging Het
Mlxipl T C 5: 135,133,370 V607A probably benign Het
Mmadhc T C 2: 50,281,161 Y213C probably benign Het
Mpo C A 11: 87,796,297 A223E probably benign Het
Muc5b C A 7: 141,864,972 A3885D probably benign Het
Mvp A G 7: 126,998,491 W152R probably damaging Het
Nmur2 A T 11: 56,040,568 F106I possibly damaging Het
Nr3c2 T A 8: 76,909,538 F423I probably damaging Het
Olfr1030 A G 2: 85,984,256 S139G probably benign Het
Olfr1500 G T 19: 13,828,229 H56N probably benign Het
Olfr355 A G 2: 36,927,337 V259A probably damaging Het
Olfr894 G A 9: 38,219,048 C75Y probably damaging Het
Pappa A G 4: 65,155,882 I224M probably damaging Het
Prex1 A C 2: 166,585,823 S800A probably damaging Het
Prkaca T C 8: 83,995,282 probably benign Het
Ptpru A T 4: 131,799,675 V662E possibly damaging Het
Rabep1 T A 11: 70,886,998 probably null Het
Rbms2 C T 10: 128,151,189 C50Y probably damaging Het
Rd3 C T 1: 191,977,453 P25S probably damaging Het
Rnf148 T G 6: 23,654,257 I247L probably benign Het
Sf3b3 A G 8: 110,812,136 probably benign Het
Slc35c1 A T 2: 92,454,513 F252Y probably damaging Het
Slc38a11 T C 2: 65,363,469 probably null Het
Snx6 G T 12: 54,768,136 Y17* probably null Het
Sox6 C A 7: 115,489,794 R611L probably damaging Het
Spata13 G A 14: 60,692,043 R350H probably damaging Het
Sppl2a G T 2: 126,904,959 A483D probably damaging Het
Stat1 C T 1: 52,149,052 probably benign Het
Tab2 A T 10: 7,919,555 Y314N probably damaging Het
Tor1aip1 T C 1: 156,030,407 N213S probably damaging Het
Trim39 T C 17: 36,261,512 K300E probably damaging Het
Tubal3 T C 13: 3,933,137 S306P probably damaging Het
Ufm1 A G 3: 53,861,234 L33P probably damaging Het
Washc4 G A 10: 83,546,799 V26I possibly damaging Het
Wfs1 A G 5: 36,968,669 Y293H probably damaging Het
Zbtb41 T C 1: 139,423,476 V109A probably damaging Het
Zfp667 T C 7: 6,304,845 S171P probably benign Het
Zkscan5 T A 5: 145,205,471 H59Q probably damaging Het
Zswim8 C T 14: 20,718,897 R1128W probably damaging Het
Other mutations in Mthfd2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Mthfd2l APN 5 91000566 missense possibly damaging 0.95
IGL03306:Mthfd2l APN 5 91020208 missense probably damaging 1.00
3-1:Mthfd2l UTSW 5 90946834 missense probably damaging 1.00
R0012:Mthfd2l UTSW 5 90961383 missense probably damaging 1.00
R0012:Mthfd2l UTSW 5 90961383 missense probably damaging 1.00
R0457:Mthfd2l UTSW 5 91020206 missense possibly damaging 0.82
R0744:Mthfd2l UTSW 5 90946942 missense probably damaging 1.00
R0833:Mthfd2l UTSW 5 90946942 missense probably damaging 1.00
R1771:Mthfd2l UTSW 5 90974395 missense probably damaging 1.00
R2226:Mthfd2l UTSW 5 90948834 nonsense probably null
R4679:Mthfd2l UTSW 5 90948911 missense probably benign 0.05
R4771:Mthfd2l UTSW 5 90948868 missense possibly damaging 0.94
R5437:Mthfd2l UTSW 5 90948898 missense possibly damaging 0.54
R7008:Mthfd2l UTSW 5 90959728 missense probably damaging 1.00
R7198:Mthfd2l UTSW 5 90946846 missense probably damaging 0.99
R7654:Mthfd2l UTSW 5 90946806
Predicted Primers PCR Primer
(F):5'- TGGAGGAGGTTGAGCACATCCTTTAT -3'
(R):5'- ATTTTGCCGGTTGTCAAATGAGTAAGC -3'

Sequencing Primer
(F):5'- gcacatcctttatatctccaccttag -3'
(R):5'- AGCAGCAGAATTCGTTTCG -3'
Posted On2013-05-23