Incidental Mutation 'R0458:Clasp2'
ID41317
Institutional Source Beutler Lab
Gene Symbol Clasp2
Ensembl Gene ENSMUSG00000033392
Gene NameCLIP associating protein 2
Synonyms1500004F14Rik, CLASP2gamma, CLASP2beta, CLASP2alpha, CLASP2, 8030404L10Rik
MMRRC Submission 038658-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0458 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location113741473-113919682 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 113906224 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111838] [ENSMUST00000163895] [ENSMUST00000166734] [ENSMUST00000213663] [ENSMUST00000214522] [ENSMUST00000215022]
Predicted Effect probably benign
Transcript: ENSMUST00000111838
AA Change: D1042E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107469
Gene: ENSMUSG00000033392
AA Change: D1042E

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 562 572 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
TOG 640 877 2.03e-1 SMART
low complexity region 995 1009 N/A INTRINSIC
TOG 1043 1274 1.49e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163895
AA Change: D1063E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128460
Gene: ENSMUSG00000033392
AA Change: D1063E

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 583 593 N/A INTRINSIC
low complexity region 635 655 N/A INTRINSIC
TOG 661 898 2.03e-1 SMART
low complexity region 1016 1030 N/A INTRINSIC
TOG 1064 1295 1.49e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166734
AA Change: D1043E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130201
Gene: ENSMUSG00000033392
AA Change: D1043E

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 562 572 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
TOG 640 878 7.51e-1 SMART
low complexity region 996 1010 N/A INTRINSIC
TOG 1044 1275 1.49e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000213663
Predicted Effect probably benign
Transcript: ENSMUST00000214522
AA Change: D1060E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000215022
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (79/79)
MGI Phenotype PHENOTYPE: Targeted deletion of this gene leads to impaired formation of stable microtubules in a wound healing assay, and results in a 2-fold reduction of directionally persistent migration in mutant embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik T C 16: 92,321,107 I98V probably benign Het
4933407L21Rik A G 1: 85,929,026 E8G unknown Het
9130008F23Rik T C 17: 40,880,236 T101A probably benign Het
Abcb8 C T 5: 24,406,233 T455I probably benign Het
Abcb9 C A 5: 124,082,146 probably null Het
Akp3 T G 1: 87,126,537 Y265* probably null Het
Atp6v1b1 A T 6: 83,752,408 D109V probably damaging Het
Aurka C A 2: 172,370,446 E4* probably null Het
Cacna1g T A 11: 94,409,440 Q2168L probably damaging Het
Cdc45 T A 16: 18,781,972 probably benign Het
Cfap61 T C 2: 146,008,917 V325A probably benign Het
Crim1 T A 17: 78,313,226 I365N probably damaging Het
Dcaf8 A G 1: 172,174,043 N269S probably benign Het
Dnaaf5 T C 5: 139,161,878 V399A possibly damaging Het
Ear2 A G 14: 44,103,248 Y121C probably damaging Het
Eef2k T C 7: 120,903,290 Y692H probably damaging Het
Elavl2 A T 4: 91,308,867 probably benign Het
Epn2 C A 11: 61,546,455 R97L possibly damaging Het
Fzd6 G A 15: 39,031,281 A281T probably damaging Het
Garem2 T A 5: 30,114,182 I214N probably damaging Het
Glg1 A G 8: 111,160,606 probably benign Het
Golm1 T C 13: 59,664,364 E48G probably damaging Het
Gpaa1 G T 15: 76,332,033 R12L probably benign Het
Gstm1 T A 3: 108,017,363 T34S probably benign Het
Gtf3c1 G A 7: 125,644,134 P1766L possibly damaging Het
Herc1 A T 9: 66,476,381 Q3709L probably benign Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Icam1 A G 9: 21,027,861 probably null Het
Itga9 T C 9: 118,681,028 probably null Het
Kif15 T C 9: 123,009,359 F1121L probably benign Het
Klhl30 T A 1: 91,360,996 probably benign Het
Ldlrad1 T C 4: 107,216,190 C141R probably damaging Het
Lemd2 T C 17: 27,190,653 D508G probably damaging Het
Lilra5 A C 7: 4,238,219 T52P probably benign Het
Lrtm2 G A 6: 119,317,268 P301S probably damaging Het
Mcoln2 A G 3: 146,150,013 probably benign Het
Mkrn2os A G 6: 115,586,670 S135P probably damaging Het
Mlxipl T C 5: 135,133,370 V607A probably benign Het
Mmadhc T C 2: 50,281,161 Y213C probably benign Het
Mpo C A 11: 87,796,297 A223E probably benign Het
Mthfd2l C G 5: 91,020,177 I310M probably damaging Het
Muc5b C A 7: 141,864,972 A3885D probably benign Het
Mvp A G 7: 126,998,491 W152R probably damaging Het
Nmur2 A T 11: 56,040,568 F106I possibly damaging Het
Nr3c2 T A 8: 76,909,538 F423I probably damaging Het
Olfr1030 A G 2: 85,984,256 S139G probably benign Het
Olfr1500 G T 19: 13,828,229 H56N probably benign Het
Olfr355 A G 2: 36,927,337 V259A probably damaging Het
Olfr894 G A 9: 38,219,048 C75Y probably damaging Het
Pappa A G 4: 65,155,882 I224M probably damaging Het
Prex1 A C 2: 166,585,823 S800A probably damaging Het
Prkaca T C 8: 83,995,282 probably benign Het
Ptpru A T 4: 131,799,675 V662E possibly damaging Het
Rabep1 T A 11: 70,886,998 probably null Het
Rbms2 C T 10: 128,151,189 C50Y probably damaging Het
Rd3 C T 1: 191,977,453 P25S probably damaging Het
Rnf148 T G 6: 23,654,257 I247L probably benign Het
Sf3b3 A G 8: 110,812,136 probably benign Het
Slc35c1 A T 2: 92,454,513 F252Y probably damaging Het
Slc38a11 T C 2: 65,363,469 probably null Het
Snx6 G T 12: 54,768,136 Y17* probably null Het
Sox6 C A 7: 115,489,794 R611L probably damaging Het
Spata13 G A 14: 60,692,043 R350H probably damaging Het
Sppl2a G T 2: 126,904,959 A483D probably damaging Het
Stat1 C T 1: 52,149,052 probably benign Het
Tab2 A T 10: 7,919,555 Y314N probably damaging Het
Tor1aip1 T C 1: 156,030,407 N213S probably damaging Het
Trim39 T C 17: 36,261,512 K300E probably damaging Het
Tubal3 T C 13: 3,933,137 S306P probably damaging Het
Ufm1 A G 3: 53,861,234 L33P probably damaging Het
Washc4 G A 10: 83,546,799 V26I possibly damaging Het
Wfs1 A G 5: 36,968,669 Y293H probably damaging Het
Zbtb41 T C 1: 139,423,476 V109A probably damaging Het
Zfp667 T C 7: 6,304,845 S171P probably benign Het
Zkscan5 T A 5: 145,205,471 H59Q probably damaging Het
Zswim8 C T 14: 20,718,897 R1128W probably damaging Het
Other mutations in Clasp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Clasp2 APN 9 113905992 splice site probably benign
IGL00885:Clasp2 APN 9 113911416 missense probably damaging 1.00
IGL01314:Clasp2 APN 9 113906127 missense possibly damaging 0.89
IGL01344:Clasp2 APN 9 113813292 splice site probably null
IGL01567:Clasp2 APN 9 113880096 missense probably damaging 1.00
IGL02238:Clasp2 APN 9 113880020 missense probably damaging 1.00
IGL02299:Clasp2 APN 9 113879989 missense probably damaging 1.00
IGL02323:Clasp2 APN 9 113868726 splice site probably benign
IGL02635:Clasp2 APN 9 113908842 missense probably damaging 0.98
IGL02645:Clasp2 APN 9 113890061 missense probably damaging 1.00
IGL02976:Clasp2 APN 9 113906136 missense probably damaging 1.00
IGL03190:Clasp2 APN 9 113844140 nonsense probably null
IGL03219:Clasp2 APN 9 113848477 splice site probably benign
PIT4810001:Clasp2 UTSW 9 113906067 missense probably damaging 1.00
R0067:Clasp2 UTSW 9 113860141 splice site probably benign
R0067:Clasp2 UTSW 9 113860141 splice site probably benign
R0421:Clasp2 UTSW 9 113854302 missense probably benign 0.02
R0432:Clasp2 UTSW 9 113909419 missense probably benign 0.00
R0865:Clasp2 UTSW 9 113911500 missense possibly damaging 0.57
R0972:Clasp2 UTSW 9 113847705 missense possibly damaging 0.58
R1037:Clasp2 UTSW 9 113896634 splice site probably benign
R1925:Clasp2 UTSW 9 113906197 missense possibly damaging 0.88
R2015:Clasp2 UTSW 9 113911500 missense possibly damaging 0.57
R2066:Clasp2 UTSW 9 113906157 missense possibly damaging 0.86
R2330:Clasp2 UTSW 9 113876304 missense probably damaging 1.00
R2568:Clasp2 UTSW 9 113878764 missense probably benign
R3011:Clasp2 UTSW 9 113901513 missense probably damaging 1.00
R3879:Clasp2 UTSW 9 113889961 missense probably damaging 0.98
R3915:Clasp2 UTSW 9 113908737 missense probably damaging 0.99
R3928:Clasp2 UTSW 9 113906105 missense probably benign 0.28
R4323:Clasp2 UTSW 9 113889959 missense possibly damaging 0.91
R4571:Clasp2 UTSW 9 113847721 missense probably damaging 1.00
R4975:Clasp2 UTSW 9 113903916 missense probably damaging 1.00
R5445:Clasp2 UTSW 9 113903946 missense probably damaging 1.00
R5564:Clasp2 UTSW 9 113812768 critical splice donor site probably null
R5697:Clasp2 UTSW 9 113860122 missense probably benign 0.01
R5780:Clasp2 UTSW 9 113850152 missense probably damaging 0.99
R5787:Clasp2 UTSW 9 113862242 missense probably damaging 1.00
R6011:Clasp2 UTSW 9 113876247 missense probably benign 0.07
R6026:Clasp2 UTSW 9 113911578 missense probably benign 0.13
R6090:Clasp2 UTSW 9 113852735 missense probably benign 0.06
R6262:Clasp2 UTSW 9 113876352 critical splice donor site probably null
R6427:Clasp2 UTSW 9 113892444 missense probably damaging 1.00
R6464:Clasp2 UTSW 9 113773717 missense probably damaging 1.00
R6586:Clasp2 UTSW 9 113813264 missense probably damaging 1.00
R6628:Clasp2 UTSW 9 113896720 missense probably damaging 1.00
R6745:Clasp2 UTSW 9 113875270 nonsense probably null
R7032:Clasp2 UTSW 9 113854323 missense probably benign 0.04
R7165:Clasp2 UTSW 9 113786399 intron probably null
R7221:Clasp2 UTSW 9 113852757 missense probably damaging 0.99
R7336:Clasp2 UTSW 9 113876353 splice site probably null
R7583:Clasp2 UTSW 9 113908687 missense probably benign 0.02
R7895:Clasp2 UTSW 9 113903948 missense probably benign 0.03
R7978:Clasp2 UTSW 9 113903948 missense probably benign 0.03
X0022:Clasp2 UTSW 9 113852672 missense probably damaging 1.00
Z1177:Clasp2 UTSW 9 113770221 missense probably damaging 1.00
Z1177:Clasp2 UTSW 9 113908795 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCAGGAGGTGATGCTGCTGAC -3'
(R):5'- TCCTTTTCCAGAGGCGACAAGAAC -3'

Sequencing Primer
(F):5'- ATCGTTGCTCCACTCAATGC -3'
(R):5'- gctgcctcctgctctctac -3'
Posted On2013-05-23