Incidental Mutation 'R0458:Snx6'
ID41328
Institutional Source Beutler Lab
Gene Symbol Snx6
Ensembl Gene ENSMUSG00000005656
Gene Namesorting nexin 6
Synonyms2810425K19Rik, 2010006G21Rik, 2610032J07Rik
MMRRC Submission 038658-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock #R0458 (G1)
Quality Score213
Status Validated
Chromosome12
Chromosomal Location54746349-54795703 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 54768136 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 17 (Y17*)
Ref Sequence ENSEMBL: ENSMUSP00000151488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005798] [ENSMUST00000218934] [ENSMUST00000219781]
Predicted Effect probably null
Transcript: ENSMUST00000005798
AA Change: Y133*
SMART Domains Protein: ENSMUSP00000005798
Gene: ENSMUSG00000005656
AA Change: Y133*

DomainStartEndE-ValueType
Pfam:PX 29 170 2.8e-21 PFAM
Pfam:Vps5 184 399 2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218337
Predicted Effect probably null
Transcript: ENSMUST00000218934
AA Change: Y17*
Predicted Effect probably benign
Transcript: ENSMUST00000219781
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein associates with the long isoform of the leptin receptor, the transforming growth factor-beta family of receptor serine-threonine kinases, and with receptor tyrosine kinases for platelet-derived growth factor, insulin, and epidermal growth factor. This protein may form oligomeric complexes with family member proteins through interactions of both the PX domain and the coiled coil regions of the molecules. Translocation of this protein from the cytoplasm to the nucleus occurs after binding to proviral integration site 1 protein. This gene results in two transcripts encoding two distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik T C 16: 92,321,107 I98V probably benign Het
4933407L21Rik A G 1: 85,929,026 E8G unknown Het
9130008F23Rik T C 17: 40,880,236 T101A probably benign Het
Abcb8 C T 5: 24,406,233 T455I probably benign Het
Abcb9 C A 5: 124,082,146 probably null Het
Akp3 T G 1: 87,126,537 Y265* probably null Het
Atp6v1b1 A T 6: 83,752,408 D109V probably damaging Het
Aurka C A 2: 172,370,446 E4* probably null Het
Cacna1g T A 11: 94,409,440 Q2168L probably damaging Het
Cdc45 T A 16: 18,781,972 probably benign Het
Cfap61 T C 2: 146,008,917 V325A probably benign Het
Clasp2 T A 9: 113,906,224 probably null Het
Crim1 T A 17: 78,313,226 I365N probably damaging Het
Dcaf8 A G 1: 172,174,043 N269S probably benign Het
Dnaaf5 T C 5: 139,161,878 V399A possibly damaging Het
Ear2 A G 14: 44,103,248 Y121C probably damaging Het
Eef2k T C 7: 120,903,290 Y692H probably damaging Het
Elavl2 A T 4: 91,308,867 probably benign Het
Epn2 C A 11: 61,546,455 R97L possibly damaging Het
Fzd6 G A 15: 39,031,281 A281T probably damaging Het
Garem2 T A 5: 30,114,182 I214N probably damaging Het
Glg1 A G 8: 111,160,606 probably benign Het
Golm1 T C 13: 59,664,364 E48G probably damaging Het
Gpaa1 G T 15: 76,332,033 R12L probably benign Het
Gstm1 T A 3: 108,017,363 T34S probably benign Het
Gtf3c1 G A 7: 125,644,134 P1766L possibly damaging Het
Herc1 A T 9: 66,476,381 Q3709L probably benign Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Icam1 A G 9: 21,027,861 probably null Het
Itga9 T C 9: 118,681,028 probably null Het
Kif15 T C 9: 123,009,359 F1121L probably benign Het
Klhl30 T A 1: 91,360,996 probably benign Het
Ldlrad1 T C 4: 107,216,190 C141R probably damaging Het
Lemd2 T C 17: 27,190,653 D508G probably damaging Het
Lilra5 A C 7: 4,238,219 T52P probably benign Het
Lrtm2 G A 6: 119,317,268 P301S probably damaging Het
Mcoln2 A G 3: 146,150,013 probably benign Het
Mkrn2os A G 6: 115,586,670 S135P probably damaging Het
Mlxipl T C 5: 135,133,370 V607A probably benign Het
Mmadhc T C 2: 50,281,161 Y213C probably benign Het
Mpo C A 11: 87,796,297 A223E probably benign Het
Mthfd2l C G 5: 91,020,177 I310M probably damaging Het
Muc5b C A 7: 141,864,972 A3885D probably benign Het
Mvp A G 7: 126,998,491 W152R probably damaging Het
Nmur2 A T 11: 56,040,568 F106I possibly damaging Het
Nr3c2 T A 8: 76,909,538 F423I probably damaging Het
Olfr1030 A G 2: 85,984,256 S139G probably benign Het
Olfr1500 G T 19: 13,828,229 H56N probably benign Het
Olfr355 A G 2: 36,927,337 V259A probably damaging Het
Olfr894 G A 9: 38,219,048 C75Y probably damaging Het
Pappa A G 4: 65,155,882 I224M probably damaging Het
Prex1 A C 2: 166,585,823 S800A probably damaging Het
Prkaca T C 8: 83,995,282 probably benign Het
Ptpru A T 4: 131,799,675 V662E possibly damaging Het
Rabep1 T A 11: 70,886,998 probably null Het
Rbms2 C T 10: 128,151,189 C50Y probably damaging Het
Rd3 C T 1: 191,977,453 P25S probably damaging Het
Rnf148 T G 6: 23,654,257 I247L probably benign Het
Sf3b3 A G 8: 110,812,136 probably benign Het
Slc35c1 A T 2: 92,454,513 F252Y probably damaging Het
Slc38a11 T C 2: 65,363,469 probably null Het
Sox6 C A 7: 115,489,794 R611L probably damaging Het
Spata13 G A 14: 60,692,043 R350H probably damaging Het
Sppl2a G T 2: 126,904,959 A483D probably damaging Het
Stat1 C T 1: 52,149,052 probably benign Het
Tab2 A T 10: 7,919,555 Y314N probably damaging Het
Tor1aip1 T C 1: 156,030,407 N213S probably damaging Het
Trim39 T C 17: 36,261,512 K300E probably damaging Het
Tubal3 T C 13: 3,933,137 S306P probably damaging Het
Ufm1 A G 3: 53,861,234 L33P probably damaging Het
Washc4 G A 10: 83,546,799 V26I possibly damaging Het
Wfs1 A G 5: 36,968,669 Y293H probably damaging Het
Zbtb41 T C 1: 139,423,476 V109A probably damaging Het
Zfp667 T C 7: 6,304,845 S171P probably benign Het
Zkscan5 T A 5: 145,205,471 H59Q probably damaging Het
Zswim8 C T 14: 20,718,897 R1128W probably damaging Het
Other mutations in Snx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Snx6 APN 12 54754309 missense probably damaging 0.99
IGL02682:Snx6 APN 12 54754345 missense probably damaging 1.00
IGL02995:Snx6 APN 12 54795510 splice site probably benign
IGL03240:Snx6 APN 12 54783443 missense probably damaging 0.98
IGL03353:Snx6 APN 12 54765684 splice site probably benign
PIT4362001:Snx6 UTSW 12 54768030 missense possibly damaging 0.80
R0610:Snx6 UTSW 12 54751789 missense probably damaging 1.00
R0689:Snx6 UTSW 12 54763656 missense probably benign 0.00
R1818:Snx6 UTSW 12 54783474 missense possibly damaging 0.95
R1819:Snx6 UTSW 12 54783474 missense possibly damaging 0.95
R4946:Snx6 UTSW 12 54770743 missense probably damaging 1.00
R5275:Snx6 UTSW 12 54784022 missense probably damaging 1.00
R5373:Snx6 UTSW 12 54770728 missense probably damaging 0.99
R5374:Snx6 UTSW 12 54770728 missense probably damaging 0.99
R5497:Snx6 UTSW 12 54757061 missense probably damaging 0.98
R5907:Snx6 UTSW 12 54754319 missense probably damaging 1.00
R5947:Snx6 UTSW 12 54770764 nonsense probably null
R6178:Snx6 UTSW 12 54760464 missense probably damaging 0.99
R6287:Snx6 UTSW 12 54747028 missense possibly damaging 0.75
R6321:Snx6 UTSW 12 54752013 missense probably damaging 1.00
R6878:Snx6 UTSW 12 54763601 intron probably null
R7055:Snx6 UTSW 12 54784079 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTCTGACTCTAAAGCATCCCGTG -3'
(R):5'- AACAAAACTTGTGTGCTGCTCTGTG -3'

Sequencing Primer
(F):5'- AGGACAGTGCTCCTCCC -3'
(R):5'- GCATGAGGCTTTCTCAGAAATG -3'
Posted On2013-05-23