Incidental Mutation 'R0458:Cdc45'
ID41336
Institutional Source Beutler Lab
Gene Symbol Cdc45
Ensembl Gene ENSMUSG00000000028
Gene Namecell division cycle 45
SynonymsCdc45l
MMRRC Submission 038658-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0458 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location18780447-18811987 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 18781972 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000094753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000028] [ENSMUST00000043577] [ENSMUST00000096990]
Predicted Effect probably benign
Transcript: ENSMUST00000000028
SMART Domains Protein: ENSMUSP00000000028
Gene: ENSMUSG00000000028

DomainStartEndE-ValueType
Pfam:CDC45 19 564 1.6e-152 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043577
SMART Domains Protein: ENSMUSP00000041925
Gene: ENSMUSG00000041378

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 181 7.6e-31 PFAM
Pfam:Claudin_2 15 182 1.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096990
SMART Domains Protein: ENSMUSP00000094753
Gene: ENSMUSG00000000028

DomainStartEndE-ValueType
Pfam:CDC45 18 74 7.9e-24 PFAM
Pfam:CDC45 73 520 4.5e-138 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified by its strong similarity with Saccharomyces cerevisiae Cdc45, an essential protein required to the initiation of DNA replication. Cdc45 is a member of the highly conserved multiprotein complex including Cdc6/Cdc18, the minichromosome maintenance proteins (MCMs) and DNA polymerase, which is important for early steps of DNA replication in eukaryotes. This protein has been shown to interact with MCM7 and DNA polymerase alpha. Studies of the similar gene in Xenopus suggested that this protein play a pivotal role in the loading of DNA polymerase alpha onto chromatin. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutant embryos do not develop after implantation, resulting in embryonic lethality between E4.5-E5.5. Heterozygous animals appear normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563D23Rik T C 16: 92,321,107 I98V probably benign Het
4933407L21Rik A G 1: 85,929,026 E8G unknown Het
9130008F23Rik T C 17: 40,880,236 T101A probably benign Het
Abcb8 C T 5: 24,406,233 T455I probably benign Het
Abcb9 C A 5: 124,082,146 probably null Het
Akp3 T G 1: 87,126,537 Y265* probably null Het
Atp6v1b1 A T 6: 83,752,408 D109V probably damaging Het
Aurka C A 2: 172,370,446 E4* probably null Het
Cacna1g T A 11: 94,409,440 Q2168L probably damaging Het
Cfap61 T C 2: 146,008,917 V325A probably benign Het
Clasp2 T A 9: 113,906,224 probably null Het
Crim1 T A 17: 78,313,226 I365N probably damaging Het
Dcaf8 A G 1: 172,174,043 N269S probably benign Het
Dnaaf5 T C 5: 139,161,878 V399A possibly damaging Het
Ear2 A G 14: 44,103,248 Y121C probably damaging Het
Eef2k T C 7: 120,903,290 Y692H probably damaging Het
Elavl2 A T 4: 91,308,867 probably benign Het
Epn2 C A 11: 61,546,455 R97L possibly damaging Het
Fzd6 G A 15: 39,031,281 A281T probably damaging Het
Garem2 T A 5: 30,114,182 I214N probably damaging Het
Glg1 A G 8: 111,160,606 probably benign Het
Golm1 T C 13: 59,664,364 E48G probably damaging Het
Gpaa1 G T 15: 76,332,033 R12L probably benign Het
Gstm1 T A 3: 108,017,363 T34S probably benign Het
Gtf3c1 G A 7: 125,644,134 P1766L possibly damaging Het
Herc1 A T 9: 66,476,381 Q3709L probably benign Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Icam1 A G 9: 21,027,861 probably null Het
Itga9 T C 9: 118,681,028 probably null Het
Kif15 T C 9: 123,009,359 F1121L probably benign Het
Klhl30 T A 1: 91,360,996 probably benign Het
Ldlrad1 T C 4: 107,216,190 C141R probably damaging Het
Lemd2 T C 17: 27,190,653 D508G probably damaging Het
Lilra5 A C 7: 4,238,219 T52P probably benign Het
Lrtm2 G A 6: 119,317,268 P301S probably damaging Het
Mcoln2 A G 3: 146,150,013 probably benign Het
Mkrn2os A G 6: 115,586,670 S135P probably damaging Het
Mlxipl T C 5: 135,133,370 V607A probably benign Het
Mmadhc T C 2: 50,281,161 Y213C probably benign Het
Mpo C A 11: 87,796,297 A223E probably benign Het
Mthfd2l C G 5: 91,020,177 I310M probably damaging Het
Muc5b C A 7: 141,864,972 A3885D probably benign Het
Mvp A G 7: 126,998,491 W152R probably damaging Het
Nmur2 A T 11: 56,040,568 F106I possibly damaging Het
Nr3c2 T A 8: 76,909,538 F423I probably damaging Het
Olfr1030 A G 2: 85,984,256 S139G probably benign Het
Olfr1500 G T 19: 13,828,229 H56N probably benign Het
Olfr355 A G 2: 36,927,337 V259A probably damaging Het
Olfr894 G A 9: 38,219,048 C75Y probably damaging Het
Pappa A G 4: 65,155,882 I224M probably damaging Het
Prex1 A C 2: 166,585,823 S800A probably damaging Het
Prkaca T C 8: 83,995,282 probably benign Het
Ptpru A T 4: 131,799,675 V662E possibly damaging Het
Rabep1 T A 11: 70,886,998 probably null Het
Rbms2 C T 10: 128,151,189 C50Y probably damaging Het
Rd3 C T 1: 191,977,453 P25S probably damaging Het
Rnf148 T G 6: 23,654,257 I247L probably benign Het
Sf3b3 A G 8: 110,812,136 probably benign Het
Slc35c1 A T 2: 92,454,513 F252Y probably damaging Het
Slc38a11 T C 2: 65,363,469 probably null Het
Snx6 G T 12: 54,768,136 Y17* probably null Het
Sox6 C A 7: 115,489,794 R611L probably damaging Het
Spata13 G A 14: 60,692,043 R350H probably damaging Het
Sppl2a G T 2: 126,904,959 A483D probably damaging Het
Stat1 C T 1: 52,149,052 probably benign Het
Tab2 A T 10: 7,919,555 Y314N probably damaging Het
Tor1aip1 T C 1: 156,030,407 N213S probably damaging Het
Trim39 T C 17: 36,261,512 K300E probably damaging Het
Tubal3 T C 13: 3,933,137 S306P probably damaging Het
Ufm1 A G 3: 53,861,234 L33P probably damaging Het
Washc4 G A 10: 83,546,799 V26I possibly damaging Het
Wfs1 A G 5: 36,968,669 Y293H probably damaging Het
Zbtb41 T C 1: 139,423,476 V109A probably damaging Het
Zfp667 T C 7: 6,304,845 S171P probably benign Het
Zkscan5 T A 5: 145,205,471 H59Q probably damaging Het
Zswim8 C T 14: 20,718,897 R1128W probably damaging Het
Other mutations in Cdc45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Cdc45 APN 16 18811561 missense probably damaging 1.00
IGL01677:Cdc45 APN 16 18787000 missense probably benign 0.02
IGL02079:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02080:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02105:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02106:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02237:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02238:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02239:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02371:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02441:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02442:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02465:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02466:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02468:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02469:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02470:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02471:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02472:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02473:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02489:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02490:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02491:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02492:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02511:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02558:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02559:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02560:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02561:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02562:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02566:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02567:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02576:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02583:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02589:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02626:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02627:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02628:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02629:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02687:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02688:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02689:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02720:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02724:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02731:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02738:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02991:Cdc45 UTSW 16 18798729 missense probably benign 0.06
R0051:Cdc45 UTSW 16 18794774 missense probably damaging 1.00
R0051:Cdc45 UTSW 16 18794774 missense probably damaging 1.00
R1398:Cdc45 UTSW 16 18781971 splice site probably benign
R1413:Cdc45 UTSW 16 18808741 missense possibly damaging 0.63
R1792:Cdc45 UTSW 16 18807340 missense probably benign 0.01
R2919:Cdc45 UTSW 16 18808793 missense probably benign 0.00
R3956:Cdc45 UTSW 16 18805430 missense probably benign 0.00
R4079:Cdc45 UTSW 16 18811360 missense probably damaging 1.00
R4825:Cdc45 UTSW 16 18784863 missense probably damaging 0.98
R5028:Cdc45 UTSW 16 18795180 missense probably benign 0.43
R5214:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5215:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5309:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5311:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5312:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5352:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5353:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5354:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5355:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5356:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5424:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5426:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5655:Cdc45 UTSW 16 18807279 critical splice donor site probably null
R6174:Cdc45 UTSW 16 18794704 intron probably null
R6796:Cdc45 UTSW 16 18784857 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGTGTTCTGATGGGAAACACAAG -3'
(R):5'- ATGCTGCCAGCCATCGTTTACC -3'

Sequencing Primer
(F):5'- CAAGTAAACGCCTCTGTTGAG -3'
(R):5'- AGGATAAGGCTCTGGACTCTC -3'
Posted On2013-05-23