Mutagenetix > Incidental Mutation

Incidental Mutation 'R0462:Tbx15'

41350

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

038662-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R0462 (G1)

Quality Score

174

Status

Not validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 99316318 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 274 (E274V)

Ref Sequence

ENSEMBL: ENSMUSP00000029462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000150756] [ENSMUST00000151606]

AlphaFold

O70306

Predicted Effect

probably damaging
Transcript: ENSMUST00000029462
AA Change: E274V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: E274V

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000150756

SMART Domains

Protein: ENSMUSP00000142358
Gene: ENSMUSG00000027868

Domain	Start	End	E-Value	Type
TBOX	6	142	2.4e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151606

SMART Domains

Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868

Domain	Start	End	E-Value	Type
Pfam:T-box	8	51	1.1e-17	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016D06Rik	T	A	8: 11,661,749		probably benign	Het
1700022I11Rik	T	A	4: 42,973,429	F921I	probably benign	Het
9530053A07Rik	A	T	7: 28,137,340	D228V	probably damaging	Het
Aarsd1	A	T	11: 101,414,091	D190E	probably damaging	Het
Acnat2	A	G	4: 49,383,084		probably null	Het
Acot10	T	G	15: 20,666,626	T10P	possibly damaging	Het
Aldh7a1	T	C	18: 56,534,214		probably null	Het
Alkbh7	G	A	17: 56,998,443	V87I	probably benign	Het
Ano2	A	T	6: 125,712,275	H121L	probably benign	Het
Apob	A	T	12: 8,000,896	Y1040F	probably damaging	Het
Arhgap25	A	T	6: 87,459,960	V636E	possibly damaging	Het
Atad2b	A	T	12: 4,941,973	T191S	possibly damaging	Het
Btbd9	A	T	17: 30,530,217	V41D	possibly damaging	Het
Bzw2	G	A	12: 36,124,024	R25C	probably damaging	Het
Carmil1	T	C	13: 24,022,511	S1326G	probably benign	Het
Cdh18	A	G	15: 23,366,885	R226G	probably damaging	Het
Cdh3	A	G	8: 106,555,380	N800S	possibly damaging	Het
Cep152	A	T	2: 125,583,934	V837E	possibly damaging	Het
Cep85	G	A	4: 134,131,421	T713M	possibly damaging	Het
Chd7	T	C	4: 8,850,821	Y1736H	probably damaging	Het
Chst3	T	C	10: 60,186,713	E104G	probably benign	Het
Cic	T	A	7: 25,287,140	S1299T	probably damaging	Het
Cic	C	A	7: 25,287,141	S1299Y	probably damaging	Het
Cmah	T	A	13: 24,436,741	S319R	possibly damaging	Het
Cnbd1	A	G	4: 18,895,044	F233L	probably benign	Het
Cpne5	T	C	17: 29,176,189	E251G	probably benign	Het
Csf2rb2	G	A	15: 78,285,173	P485L	probably damaging	Het
Dimt1	T	C	13: 106,948,756	M70T	possibly damaging	Het
Dlk2	A	G	17: 46,303,098	*383W	probably null	Het
Dnah2	G	A	11: 69,459,201	R2369C	probably damaging	Het
Dock2	A	G	11: 34,268,052	F1173L	possibly damaging	Het
Dok7	A	G	5: 35,066,462	H115R	possibly damaging	Het
Dpy19l1	A	G	9: 24,414,349	I720T	probably benign	Het
Eps8	A	T	6: 137,514,311	D356E	probably benign	Het
Exoc1	A	G	5: 76,543,617	N263D	probably benign	Het
Fam173b	T	C	15: 31,616,872	M161T	probably damaging	Het
Fbxl3	T	C	14: 103,082,886	D375G	probably damaging	Het
Flg2	A	T	3: 93,201,437	E257D	probably benign	Het
Fstl4	A	G	11: 53,186,402	D662G	probably benign	Het
Gbp10	G	T	5: 105,218,524	Q505K	possibly damaging	Het
Gemin2	C	T	12: 59,013,519	P15S	probably damaging	Het
Gm14124	A	G	2: 150,269,202	E604G	possibly damaging	Het
Grhl2	A	G	15: 37,344,675	M514V	probably benign	Het
Hgs	A	G	11: 120,479,144	N413D	possibly damaging	Het
Il12rb2	T	C	6: 67,303,610	S538G	possibly damaging	Het
Kdm5a	A	G	6: 120,402,600	D623G	probably damaging	Het
Kif1bp	A	T	10: 62,559,456	I469N	probably damaging	Het
Matk	G	T	10: 81,259,693	V116F	probably damaging	Het
Mcm3	T	C	1: 20,805,332	T694A	probably benign	Het
Mctp1	C	A	13: 76,801,401	H260Q	probably damaging	Het
Mios	T	A	6: 8,215,743	I313K	probably benign	Het
Muc4	T	A	16: 32,762,536	Y2562N	possibly damaging	Het
Naip5	T	A	13: 100,221,732	I999F	probably damaging	Het
Olfr128	A	T	17: 37,923,776	D70V	probably damaging	Het
Olfr1375	A	G	11: 51,048,509	Y134C	probably damaging	Het
Olfr68	A	T	7: 103,777,563	S261T	probably benign	Het
Olfr749	T	A	14: 50,737,097	I22L	probably benign	Het
Olfr834	A	T	9: 18,988,902	I305F	probably benign	Het
Olfr965	T	A	9: 39,719,410	F61Y	probably benign	Het
Pafah1b1	A	G	11: 74,677,715	V396A	probably benign	Het
Pard6b	T	A	2: 168,087,547	I91N	possibly damaging	Het
Pdzd2	T	C	15: 12,592,160	S133G	probably damaging	Het
Plcg2	T	G	8: 117,585,305	S445R	probably benign	Het
Plekhd1	G	T	12: 80,721,578	V396L	probably damaging	Het
Ppp4r2	A	G	6: 100,866,557	D294G	possibly damaging	Het
Ppwd1	T	C	13: 104,222,960		probably null	Het
Prr22	A	G	17: 56,770,551		probably benign	Het
Psme4	A	G	11: 30,848,117	D1370G	probably damaging	Het
Rac3	T	A	11: 120,722,858	V86D	probably damaging	Het
Rnf207	T	C	4: 152,313,372	S335G	possibly damaging	Het
Rxfp3	A	G	15: 11,036,977	L103P	probably damaging	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Smpdl3a	G	T	10: 57,794,731	C17F	probably benign	Het
Spen	A	T	4: 141,473,651	I2555N	probably damaging	Het
Srpk2	G	T	5: 23,518,426	T564K	probably damaging	Het
Stard4	C	T	18: 33,205,149	R116H	probably damaging	Het
Supt7l	A	T	5: 31,520,296	S175R	probably damaging	Het
Sycp1	A	T	3: 102,819,106	Y932N	possibly damaging	Het
Tas2r122	T	C	6: 132,711,178	M251V	probably benign	Het
Tex52	A	G	6: 128,384,954	E298G	probably benign	Het
Tmem101	T	C	11: 102,155,867	M59V	probably benign	Het
Tmem132b	T	C	5: 125,785,926	V665A	probably damaging	Het
Trim23	T	C	13: 104,198,033	V347A	probably damaging	Het
Ush2a	A	G	1: 188,910,939	H4166R	probably benign	Het
Vmn2r101	G	T	17: 19,590,169	V406L	probably benign	Het
Vrk3	A	G	7: 44,764,200	D166G	possibly damaging	Het
Washc4	T	A	10: 83,556,913	M259K	probably benign	Het
Wdr70	T	C	15: 8,079,161	D167G	probably benign	Het
Zfp28	A	T	7: 6,392,240	Q248L	possibly damaging	Het
Zfp39	A	G	11: 58,890,406	I510T	probably benign	Het
Zfp710	T	A	7: 80,090,341	*646R	probably null	Het
Zfp90	C	T	8: 106,425,260	S535L	possibly damaging	Het
Zfp949	C	T	9: 88,568,734	T119I	possibly damaging	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCATGCCCAGCCTAAACTTTCC -3'
(R):5'- ACTGTCATCACTGTTTCATGTGTGCTAT -3'

Sequencing Primer
(F):5'- CTAAACTTTCCTCTTTGCATTTCAG -3'
(R):5'- gtttttgttgttgttgttgttgttg -3'

Posted On

2013-05-23