Incidental Mutation 'R0462:Tbx15'
ID 41350
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene Name T-box 15
Synonyms Tbx8, de, Tbx14
MMRRC Submission 038662-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.930) question?
Stock # R0462 (G1)
Quality Score 174
Status Not validated
Chromosome 3
Chromosomal Location 99147697-99261575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 99223634 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 274 (E274V)
Ref Sequence ENSEMBL: ENSMUSP00000029462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000150756] [ENSMUST00000151606]
AlphaFold O70306
Predicted Effect probably damaging
Transcript: ENSMUST00000029462
AA Change: E274V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: E274V

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150756
SMART Domains Protein: ENSMUSP00000142358
Gene: ENSMUSG00000027868

DomainStartEndE-ValueType
TBOX 6 142 2.4e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151606
SMART Domains Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868

DomainStartEndE-ValueType
Pfam:T-box 8 51 1.1e-17 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 A T 11: 101,304,917 (GRCm39) D190E probably damaging Het
Acnat2 A G 4: 49,383,084 (GRCm39) probably null Het
Acot10 T G 15: 20,666,712 (GRCm39) T10P possibly damaging Het
Aldh7a1 T C 18: 56,667,286 (GRCm39) probably null Het
Alkbh7 G A 17: 57,305,443 (GRCm39) V87I probably benign Het
Ano2 A T 6: 125,689,238 (GRCm39) H121L probably benign Het
Apob A T 12: 8,050,896 (GRCm39) Y1040F probably damaging Het
Arhgap25 A T 6: 87,436,942 (GRCm39) V636E possibly damaging Het
Atad2b A T 12: 4,991,973 (GRCm39) T191S possibly damaging Het
Atpsckmt T C 15: 31,617,018 (GRCm39) M161T probably damaging Het
Btbd9 A T 17: 30,749,191 (GRCm39) V41D possibly damaging Het
Bzw2 G A 12: 36,174,023 (GRCm39) R25C probably damaging Het
Carmil1 T C 13: 24,206,494 (GRCm39) S1326G probably benign Het
Cdh18 A G 15: 23,366,971 (GRCm39) R226G probably damaging Het
Cdh3 A G 8: 107,282,012 (GRCm39) N800S possibly damaging Het
Cep152 A T 2: 125,425,854 (GRCm39) V837E possibly damaging Het
Cep85 G A 4: 133,858,732 (GRCm39) T713M possibly damaging Het
Chd7 T C 4: 8,850,821 (GRCm39) Y1736H probably damaging Het
Chst3 T C 10: 60,022,535 (GRCm39) E104G probably benign Het
Cic T A 7: 24,986,565 (GRCm39) S1299T probably damaging Het
Cic C A 7: 24,986,566 (GRCm39) S1299Y probably damaging Het
Cmah T A 13: 24,620,724 (GRCm39) S319R possibly damaging Het
Cnbd1 A G 4: 18,895,044 (GRCm39) F233L probably benign Het
Cpne5 T C 17: 29,395,163 (GRCm39) E251G probably benign Het
Csf2rb2 G A 15: 78,169,373 (GRCm39) P485L probably damaging Het
Dimt1 T C 13: 107,085,264 (GRCm39) M70T possibly damaging Het
Dlk2 A G 17: 46,614,024 (GRCm39) *383W probably null Het
Dnah2 G A 11: 69,350,027 (GRCm39) R2369C probably damaging Het
Dock2 A G 11: 34,218,052 (GRCm39) F1173L possibly damaging Het
Dok7 A G 5: 35,223,806 (GRCm39) H115R possibly damaging Het
Dpy19l1 A G 9: 24,325,645 (GRCm39) I720T probably benign Het
Eps8 A T 6: 137,491,309 (GRCm39) D356E probably benign Het
Exoc1 A G 5: 76,691,464 (GRCm39) N263D probably benign Het
Fbxl3 T C 14: 103,320,322 (GRCm39) D375G probably damaging Het
Fcgbpl1 A T 7: 27,836,765 (GRCm39) D228V probably damaging Het
Flg2 A T 3: 93,108,744 (GRCm39) E257D probably benign Het
Fstl4 A G 11: 53,077,229 (GRCm39) D662G probably benign Het
Gbp10 G T 5: 105,366,390 (GRCm39) Q505K possibly damaging Het
Gemin2 C T 12: 59,060,305 (GRCm39) P15S probably damaging Het
Grhl2 A G 15: 37,344,919 (GRCm39) M514V probably benign Het
Hgs A G 11: 120,369,970 (GRCm39) N413D possibly damaging Het
Il12rb2 T C 6: 67,280,594 (GRCm39) S538G possibly damaging Het
Kdm5a A G 6: 120,379,561 (GRCm39) D623G probably damaging Het
Kifbp A T 10: 62,395,235 (GRCm39) I469N probably damaging Het
Matk G T 10: 81,095,527 (GRCm39) V116F probably damaging Het
Mcm3 T C 1: 20,875,556 (GRCm39) T694A probably benign Het
Mctp1 C A 13: 76,949,520 (GRCm39) H260Q probably damaging Het
Mios T A 6: 8,215,743 (GRCm39) I313K probably benign Het
Muc4 T A 16: 32,582,910 (GRCm39) Y2562N possibly damaging Het
Naip5 T A 13: 100,358,240 (GRCm39) I999F probably damaging Het
Or11h4 T A 14: 50,974,554 (GRCm39) I22L probably benign Het
Or14j7 A T 17: 38,234,667 (GRCm39) D70V probably damaging Het
Or1x6 A G 11: 50,939,336 (GRCm39) Y134C probably damaging Het
Or52a5 A T 7: 103,426,770 (GRCm39) S261T probably benign Het
Or7g12 A T 9: 18,900,198 (GRCm39) I305F probably benign Het
Or8g52 T A 9: 39,630,706 (GRCm39) F61Y probably benign Het
Pafah1b1 A G 11: 74,568,541 (GRCm39) V396A probably benign Het
Pard6b T A 2: 167,929,467 (GRCm39) I91N possibly damaging Het
Pdzd2 T C 15: 12,592,246 (GRCm39) S133G probably damaging Het
Plcg2 T G 8: 118,312,044 (GRCm39) S445R probably benign Het
Plekhd1 G T 12: 80,768,352 (GRCm39) V396L probably damaging Het
Ppp4r2 A G 6: 100,843,518 (GRCm39) D294G possibly damaging Het
Ppwd1 T C 13: 104,359,468 (GRCm39) probably null Het
Prr22 A G 17: 57,077,551 (GRCm39) probably benign Het
Psme4 A G 11: 30,798,117 (GRCm39) D1370G probably damaging Het
Rac3 T A 11: 120,613,684 (GRCm39) V86D probably damaging Het
Rnf207 T C 4: 152,397,829 (GRCm39) S335G possibly damaging Het
Rxfp3 A G 15: 11,037,063 (GRCm39) L103P probably damaging Het
Slc17a3 C T 13: 24,039,841 (GRCm39) S293F probably damaging Het
Smpdl3a G T 10: 57,670,827 (GRCm39) C17F probably benign Het
Spaca7b T A 8: 11,711,749 (GRCm39) probably benign Het
Spata31g1 T A 4: 42,973,429 (GRCm39) F921I probably benign Het
Spen A T 4: 141,200,962 (GRCm39) I2555N probably damaging Het
Srpk2 G T 5: 23,723,424 (GRCm39) T564K probably damaging Het
Stard4 C T 18: 33,338,202 (GRCm39) R116H probably damaging Het
Supt7l A T 5: 31,677,640 (GRCm39) S175R probably damaging Het
Sycp1 A T 3: 102,726,422 (GRCm39) Y932N possibly damaging Het
Tas2r122 T C 6: 132,688,141 (GRCm39) M251V probably benign Het
Tex52 A G 6: 128,361,917 (GRCm39) E298G probably benign Het
Tmem101 T C 11: 102,046,693 (GRCm39) M59V probably benign Het
Tmem132b T C 5: 125,862,990 (GRCm39) V665A probably damaging Het
Trim23 T C 13: 104,334,541 (GRCm39) V347A probably damaging Het
Ush2a A G 1: 188,643,136 (GRCm39) H4166R probably benign Het
Vmn2r101 G T 17: 19,810,431 (GRCm39) V406L probably benign Het
Vrk3 A G 7: 44,413,624 (GRCm39) D166G possibly damaging Het
Washc4 T A 10: 83,392,777 (GRCm39) M259K probably benign Het
Wdr70 T C 15: 8,108,645 (GRCm39) D167G probably benign Het
Zfp1005 A G 2: 150,111,122 (GRCm39) E604G possibly damaging Het
Zfp28 A T 7: 6,395,239 (GRCm39) Q248L possibly damaging Het
Zfp39 A G 11: 58,781,232 (GRCm39) I510T probably benign Het
Zfp710 T A 7: 79,740,089 (GRCm39) *646R probably null Het
Zfp90 C T 8: 107,151,892 (GRCm39) S535L possibly damaging Het
Zfp949 C T 9: 88,450,787 (GRCm39) T119I possibly damaging Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99,223,562 (GRCm39) missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99,223,544 (GRCm39) missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99,220,358 (GRCm39) missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99,259,800 (GRCm39) missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99,259,826 (GRCm39) missense probably benign 0.01
IGL03143:Tbx15 APN 3 99,259,514 (GRCm39) missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99,259,296 (GRCm39) missense probably benign 0.00
shin_guard UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
Shortcut UTSW 3 99,220,389 (GRCm39) nonsense probably null
R0012:Tbx15 UTSW 3 99,259,412 (GRCm39) missense probably benign
R0109:Tbx15 UTSW 3 99,259,182 (GRCm39) missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99,259,707 (GRCm39) missense probably damaging 1.00
R1134:Tbx15 UTSW 3 99,223,639 (GRCm39) missense probably damaging 0.98
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1506:Tbx15 UTSW 3 99,259,228 (GRCm39) missense possibly damaging 0.80
R1681:Tbx15 UTSW 3 99,259,140 (GRCm39) splice site probably null
R1762:Tbx15 UTSW 3 99,259,260 (GRCm39) nonsense probably null
R1789:Tbx15 UTSW 3 99,259,562 (GRCm39) nonsense probably null
R2167:Tbx15 UTSW 3 99,233,771 (GRCm39) splice site probably benign
R2254:Tbx15 UTSW 3 99,259,190 (GRCm39) missense possibly damaging 0.52
R2357:Tbx15 UTSW 3 99,223,672 (GRCm39) splice site probably null
R2441:Tbx15 UTSW 3 99,259,827 (GRCm39) missense probably damaging 0.99
R3010:Tbx15 UTSW 3 99,161,209 (GRCm39) intron probably benign
R3118:Tbx15 UTSW 3 99,259,470 (GRCm39) missense probably damaging 0.96
R4081:Tbx15 UTSW 3 99,220,370 (GRCm39) missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99,259,683 (GRCm39) missense probably damaging 1.00
R4898:Tbx15 UTSW 3 99,259,583 (GRCm39) missense possibly damaging 0.95
R4950:Tbx15 UTSW 3 99,233,700 (GRCm39) missense possibly damaging 0.82
R4982:Tbx15 UTSW 3 99,161,390 (GRCm39) missense probably benign 0.06
R4999:Tbx15 UTSW 3 99,223,649 (GRCm39) missense probably damaging 1.00
R5236:Tbx15 UTSW 3 99,259,362 (GRCm39) missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99,223,600 (GRCm39) missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
R5493:Tbx15 UTSW 3 99,259,880 (GRCm39) missense probably benign
R5690:Tbx15 UTSW 3 99,216,166 (GRCm39) missense probably damaging 0.99
R5756:Tbx15 UTSW 3 99,220,402 (GRCm39) missense probably damaging 1.00
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6156:Tbx15 UTSW 3 99,220,431 (GRCm39) critical splice donor site probably null
R6173:Tbx15 UTSW 3 99,161,203 (GRCm39) nonsense probably null
R6596:Tbx15 UTSW 3 99,259,508 (GRCm39) missense probably benign
R6680:Tbx15 UTSW 3 99,220,389 (GRCm39) nonsense probably null
R6931:Tbx15 UTSW 3 99,259,467 (GRCm39) missense probably damaging 1.00
R8129:Tbx15 UTSW 3 99,161,254 (GRCm39) missense probably damaging 1.00
R8155:Tbx15 UTSW 3 99,259,886 (GRCm39) missense possibly damaging 0.69
R8230:Tbx15 UTSW 3 99,259,305 (GRCm39) missense probably damaging 1.00
R8729:Tbx15 UTSW 3 99,220,376 (GRCm39) missense possibly damaging 0.90
R8929:Tbx15 UTSW 3 99,222,219 (GRCm39) missense probably damaging 1.00
R9038:Tbx15 UTSW 3 99,222,085 (GRCm39) missense probably benign 0.14
R9688:Tbx15 UTSW 3 99,233,708 (GRCm39) missense possibly damaging 0.89
R9746:Tbx15 UTSW 3 99,259,647 (GRCm39) missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99,222,151 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCATGCCCAGCCTAAACTTTCC -3'
(R):5'- ACTGTCATCACTGTTTCATGTGTGCTAT -3'

Sequencing Primer
(F):5'- CTAAACTTTCCTCTTTGCATTTCAG -3'
(R):5'- gtttttgttgttgttgttgttgttg -3'
Posted On 2013-05-23